View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF6459_low_37 (Length: 236)

Name: NF6459_low_37
Description: NF6459
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF6459_low_37
NF6459_low_37
[»] chr4 (2 HSPs)
chr4 (1-80)||(43605983-43606062)
chr4 (153-236)||(43605826-43605910)


Alignment Details
Target: chr4 (Bit Score: 72; Significance: 7e-33; HSPs: 2)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 72; E-Value: 7e-33
Query Start/End: Original strand, 1 - 80
Target Start/End: Complemental strand, 43606062 - 43605983
Alignment:
1 ctaatttgagtttcacactacattctgatagctgttttcagtggaggtagtgataaactctaatgagtagaggtagtgat 80  Q
    ||||||| ||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||    
43606062 ctaattttagtttcacactacattcagatagctgttttcagtggaggtagtgataaactctaatgagtagaggtagtgat 43605983  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #2
Raw Score: 45; E-Value: 9e-17
Query Start/End: Original strand, 153 - 236
Target Start/End: Complemental strand, 43605910 - 43605826
Alignment:
153 agttatggattgcttaaaatgtgctctaagggtacaagataacatc-tcnnnnnnnnattataaaagttgtgaagttagtataat 236  Q
    ||||||||||||||||||||||||||||||||||||||||| |||| ||        ||||||||||||||||||||| ||||||    
43605910 agttatggattgcttaaaatgtgctctaagggtacaagatagcatcttcttttttctattataaaagttgtgaagttattataat 43605826  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University