View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6459_low_7 (Length: 498)
Name: NF6459_low_7
Description: NF6459
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6459_low_7 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 380; Significance: 0; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 380; E-Value: 0
Query Start/End: Original strand, 7 - 402
Target Start/End: Complemental strand, 12396143 - 12395748
Alignment:
| Q |
7 |
tagattatactctttcgatttcgaaactgaaaatcaacgcgatccaaacttccatgttttcacaacactcaaaaatctcattcaaaaatggacgacaaaa |
106 |
Q |
| |
|
||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
12396143 |
tagattacactctttcgatttcgaaactgaaaatcaacgcgatccaaacttccatgttttcacaacactcaaaaatctcattcaaaaatggacgacaaaa |
12396044 |
T |
|
| Q |
107 |
cgcactccaacaacgaccacgaacaactttctgaacaagcaacacaagatgccgctggcggcggaagttggggtggttggggcttttcttccattctctc |
206 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
12396043 |
cgcactccaacaacgaccacgaacaactttctgaacaagcaacacaagatgccggtggcggcggaagttggggtggttggggcttttcttccattctctc |
12395944 |
T |
|
| Q |
207 |
cgatcttcaaaaagctgccgctgttgccgccgaagagatctctcgcaatgtacgtttcactacaatacgatgtcgttttatgcattcatttttatctctt |
306 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||| |
|
|
| T |
12395943 |
cgatcttcaaaaagctgccgctgttgccgccgaagagatctctcgcaatgtacgtttcactacaatacgatgtcgttttatgcattcatatttatctctt |
12395844 |
T |
|
| Q |
307 |
aattactgttaaatgtggttgttttgtgtttattcattaatttttaaaaatggaattagggttatgggatttattatgtaattacaaatattttac |
402 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
12395843 |
aattactgttaaatgtggttgttttgtgtttattaattaatttttaaaaatggaattagggttatgggatttattatgtaattacaaatattttac |
12395748 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University