View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6461_low_5 (Length: 243)
Name: NF6461_low_5
Description: NF6461
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6461_low_5 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 111; Significance: 4e-56; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 111; E-Value: 4e-56
Query Start/End: Original strand, 125 - 235
Target Start/End: Original strand, 11452286 - 11452396
Alignment:
| Q |
125 |
tactagttaccatcataatgagaaggaggaaaagcattgggaataagaaaaagctggtagaacatggcagcagagaagagaagaagaggaagtgcgtagg |
224 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
11452286 |
tactagttaccatcataatgagaaggaggaaaagcattgggaataagaaaaagctggtagaacatggcagcagagaagagaagaagaggaagtgcgtagg |
11452385 |
T |
 |
| Q |
225 |
ctttgatgatg |
235 |
Q |
| |
|
||||||||||| |
|
|
| T |
11452386 |
ctttgatgatg |
11452396 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 58; E-Value: 2e-24
Query Start/End: Original strand, 1 - 62
Target Start/End: Original strand, 11452163 - 11452224
Alignment:
| Q |
1 |
ttgacataagcctccttcacttcatcaatcgaactatacatcttaattctcagaactgcatt |
62 |
Q |
| |
|
||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
11452163 |
ttgacataagcttccttcacttcatcaatcgaactatacatcttaattctcagaactgcatt |
11452224 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University