View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6462_high_10 (Length: 299)
Name: NF6462_high_10
Description: NF6462
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6462_high_10 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 193; Significance: 1e-105; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 193; E-Value: 1e-105
Query Start/End: Original strand, 20 - 275
Target Start/End: Complemental strand, 30289578 - 30289321
Alignment:
| Q |
20 |
ctacccattcccttgttatttgtttacattgtttatgtaatcttttgaaacatattactcttctaacatgatgatgatattatcatgttctaacatgttt |
119 |
Q |
| |
|
|||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
30289578 |
ctactcattcccttgttatttgtttacattgtttatgtaatcttttgaaacatattactcttctaacatgatgatgatattatcatgttctaacatgttt |
30289479 |
T |
 |
| Q |
120 |
tttgttactgtgttatagattgaaaattccatcgtcctttattaatgaccaacctcagtttcaaa--tttaacacaaaatgaaatcttattctccaaatt |
217 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||| ||||||||||| |
|
|
| T |
30289478 |
tttgttactgtgttatagattgaaaattccatcgtcctttattaatgaccaacctcagtttcaaacttttaacacaaaatgaaatctt-ttctccaaatt |
30289380 |
T |
 |
| Q |
218 |
ga-nnnnnnnnncatccataaaagtcaagatcaaatctacaatcaattactgtttcgta |
275 |
Q |
| |
|
|| |||||||||||||||||||||||||||| | |||||||||||||||| |
|
|
| T |
30289379 |
gattttttttttcatccataaaagtcaagatcaaatctacgaccaattactgtttcgta |
30289321 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University