View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6462_high_11 (Length: 269)
Name: NF6462_high_11
Description: NF6462
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6462_high_11 |
 | |
|
| [»] chr5 (1 HSPs) |
| |
|
Alignment Details
Target: chr5 (Bit Score: 252; Significance: 1e-140; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 252; E-Value: 1e-140
Query Start/End: Original strand, 6 - 269
Target Start/End: Complemental strand, 6083682 - 6083419
Alignment:
| Q |
6 |
agaagcaaaggactccccacagctaacattgtcatcactgccaatgtaagacattgatgccaaagataactcttgcaatgcaacatgacttctaggctgc |
105 |
Q |
| |
|
|||||| ||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6083682 |
agaagccaaggactccccgcagctaacattgtcatcactgccaatgtaagacattgatgccaaagataactcttgcaatgcaacatgacttctaggctgc |
6083583 |
T |
|
| Q |
106 |
tccgatgctacttggtttttggaatcaatctcagattcaagttgcaacagttttgacgctgtttgcgaaagcattactcttgaaaattggacttcatttc |
205 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6083582 |
tccgatgctacttggtttttggaatcaatctcagactcaagttgcaacagttttgacgctgtttgcgaaagcattactcttgaaaattggacttcatttc |
6083483 |
T |
|
| Q |
206 |
gaatatcaagttccttttgaagcactcgagcctcatacatcagagaagtattatccttctcaac |
269 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6083482 |
gaatatcaagttccttttgaagcactcgagcctcatacatcagagaagtattatccttctcaac |
6083419 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 33; Significance: 0.000000001; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 23 - 71
Target Start/End: Original strand, 39107390 - 39107438
Alignment:
| Q |
23 |
cacagctaacattgtcatcactgccaatgtaagacattgatgccaaaga |
71 |
Q |
| |
|
|||||||||| ||||||||||||||||| | |||| ||||||||||||| |
|
|
| T |
39107390 |
cacagctaaccttgtcatcactgccaatatcagacgttgatgccaaaga |
39107438 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University