View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6462_low_17 (Length: 210)
Name: NF6462_low_17
Description: NF6462
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6462_low_17 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 128; Significance: 2e-66; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 128; E-Value: 2e-66
Query Start/End: Original strand, 19 - 194
Target Start/End: Original strand, 53466241 - 53466412
Alignment:
| Q |
19 |
gagcgatacttaaatgaggagatgtatatataccttgccctttaatannnnnnnngtaaacatggtgtccaaaaccacgtatatgttataatattcctgt |
118 |
Q |
| |
|
||||||||||||||||||||||||||||||| |||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
53466241 |
gagcgatacttaaatgaggagatgtatatat--cttgccctttaatatttttt--gtaaacatggtgtccaaaaccacgtatatgttataatattcctgt |
53466336 |
T |
|
| Q |
119 |
gtttagactcttcttgcgatccaacaatagtatcgaaaccaatgatttgagttacaaatgactgactccttgtatc |
194 |
Q |
| |
|
||||||||||| || ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
53466337 |
gtttagactctcctcgcgatccaacaatagtatcgaaaccaatgatttgagttacaaatgactgactccttgtatc |
53466412 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University