View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6462_low_4 (Length: 435)
Name: NF6462_low_4
Description: NF6462
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6462_low_4 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 408; Significance: 0; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 408; E-Value: 0
Query Start/End: Original strand, 1 - 420
Target Start/End: Original strand, 15177303 - 15177722
Alignment:
| Q |
1 |
agcataggacttaacctgtgaagggtgaaggattcttgaagtgaggttgcgtcttaagaggcgccaaatgggaccgtagaagctaaagaggatgtcatgt |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
15177303 |
agcataggacttaacctgtgaagggtgaaggattcttgaagtgaggttgcgtcttaagaggcgccaaatgggaccgtagaagctaaagaggatgtcatgt |
15177402 |
T |
 |
| Q |
101 |
tgattgctgctaattatcttctttgtgggaatcgcctcagggcgatcagcgaatatggtgctattttggattaatgcttgatgtgcaagaaatctattgg |
200 |
Q |
| |
|
||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
15177403 |
tgattgctgctaattatcttctttgtgggaaccgcctcagggcgatcagcgaatatggtgctattttggattaatgcttgatgtgcaagaaatctattgg |
15177502 |
T |
 |
| Q |
201 |
caatgaaaatgtcggtgttagaacccatttgaagagtgaagattgaaccatatttggcatgaagatcttgaagaagggttttaggatctttaaagaattg |
300 |
Q |
| |
|
||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
15177503 |
caatgtaaatgtcggtgttagaacccatttgaagagtgaagattgaaccatatttggcatgaagatcttgaagaagggttttaggatctttaaagaattg |
15177602 |
T |
 |
| Q |
301 |
atttaacactgtgaatgtccctatgatgggtagtttgggaggtcctggaggcaggtgagatttagggaaaataaggtttcttatgaatttgagaattagt |
400 |
Q |
| |
|
|||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
15177603 |
atttaacaatgtgaatgtccctatgatgggtagtttgggaggtcctggaggcaggtgagatttagggaaaataaggtttcttatgaatttgagaattagt |
15177702 |
T |
 |
| Q |
401 |
gaaagaagaaggcacaaaat |
420 |
Q |
| |
|
|||||||||||||||||||| |
|
|
| T |
15177703 |
gaaagaagaaggcacaaaat |
15177722 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University