View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6462_low_7 (Length: 380)
Name: NF6462_low_7
Description: NF6462
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6462_low_7 |
 | |
|
| [»] scaffold0098 (1 HSPs) |
| | |
|
Alignment Details
Target: scaffold0098 (Bit Score: 73; Significance: 3e-33; HSPs: 1)
Name: scaffold0098
Description:
Target: scaffold0098; HSP #1
Raw Score: 73; E-Value: 3e-33
Query Start/End: Original strand, 255 - 364
Target Start/End: Complemental strand, 52610 - 52501
Alignment:
| Q |
255 |
aaagctacgagtaaactcatttgacatgtttgaagattgggtnnnnnnnttgtttgaatttgaaaatgaaaggaatgacacaaaaagaggagaaaagatg |
354 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| |||||| ||||||||||||||||||||||||||||||| ||||||||||||||||||| |
|
|
| T |
52610 |
aaagctacgagtaaactcatttgacatgtttgaaggttgggtaaaaaaattgtttgaatttgaaaatgaaaggaatgacataaaaagaggagaaaagatg |
52511 |
T |
|
| Q |
355 |
agcggataaa |
364 |
Q |
| |
|
| ||| |||| |
|
|
| T |
52510 |
aacgggtaaa |
52501 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University