View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6464_high_19 (Length: 255)
Name: NF6464_high_19
Description: NF6464
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6464_high_19 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 138; Significance: 3e-72; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 138; E-Value: 3e-72
Query Start/End: Original strand, 21 - 194
Target Start/End: Original strand, 29810959 - 29811134
Alignment:
| Q |
21 |
atagtaaatgatgatgactagtgatgaacgaggaacatggaagtccttccacaaaaataagagcatatatgctttcacaagtggctt--tagcaagaatg |
118 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| |||||||||||||| ||||||||||| |
|
|
| T |
29810959 |
atagtaaatgatgatgactagtgatgaacgaggaacatggaagtccttccacaaaaataagagcatttatgc-ttcacaagtggctttatagcaagaatg |
29811057 |
T |
|
| Q |
119 |
cggtattcgtaagagaatgggcaatatatggttggttgtttcatac-tttccattatattaatgatgatgtaccaag |
194 |
Q |
| |
|
|||||||||||||||||||||||||| |||| |||||||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
29811058 |
cggtattcgtaagagaatgggcaatacatggctggttgtttcatacttttccattatattaatgatgatgtaccaag |
29811134 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 210 - 245
Target Start/End: Original strand, 29811151 - 29811186
Alignment:
| Q |
210 |
cactagttgaccttctagtatcacagcttacctatg |
245 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| |
|
|
| T |
29811151 |
cactagttgaccttctagtatcacagcttacctatg |
29811186 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University