View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6464_high_26 (Length: 230)
Name: NF6464_high_26
Description: NF6464
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6464_high_26 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 86; Significance: 3e-41; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 86; E-Value: 3e-41
Query Start/End: Original strand, 1 - 94
Target Start/End: Complemental strand, 33657918 - 33657825
Alignment:
| Q |
1 |
ctatggatccatgttcttagcttgatcatgctctttttcaactcaccccaacaagaacaaggttcttttccttaactttacaaaaataaaaaag |
94 |
Q |
| |
|
||||||||||| ||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33657918 |
ctatggatccaagttcttatcttgatcatgctctttttcaactcaccccaacaagaacaaggttcttttccttaactttacaaaaataaaaaag |
33657825 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 43; E-Value: 0.000000000000001
Query Start/End: Original strand, 165 - 215
Target Start/End: Complemental strand, 33657754 - 33657704
Alignment:
| Q |
165 |
ctagtgatgttagcgaaagactagcttctgggctgttagaaccgtttgttt |
215 |
Q |
| |
|
|||||| |||||| ||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33657754 |
ctagtggtgttagtgaaagactagcttctgggctgttagaaccgtttgttt |
33657704 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University