View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6464_high_30 (Length: 206)
Name: NF6464_high_30
Description: NF6464
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6464_high_30 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 170; Significance: 2e-91; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 170; E-Value: 2e-91
Query Start/End: Original strand, 11 - 188
Target Start/End: Complemental strand, 26614824 - 26614648
Alignment:
| Q |
11 |
catcatcatagaaattgtcaccagttgaaactacaaaatcaatgtcaagcttctctccaaccactcccatctgcaatcaaataaatttcattttgtaagt |
110 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
26614824 |
catcatcatagaaattgtcaccagttgaaactacaaaatcaatgtcaagcttctctccaaccactcccatctgcaatcaaataaatttcattttgtaagt |
26614725 |
T |
 |
| Q |
111 |
ttttattttgtacaaaaagtgcttatgattatgaatgaatgaatgatcataacttataaaaatagcttatacgacaac |
188 |
Q |
| |
|
|||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
26614724 |
ttttattttgtacaaaaagtgcttatgatt-tgaatgaatgaatgatcataacttataaaaatagcttatacgacaac |
26614648 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University