View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6464_high_5 (Length: 379)
Name: NF6464_high_5
Description: NF6464
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6464_high_5 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 172; Significance: 2e-92; HSPs: 4)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 172; E-Value: 2e-92
Query Start/End: Original strand, 11 - 186
Target Start/End: Original strand, 4065094 - 4065269
Alignment:
| Q |
11 |
cagagattcaaataacctggaatttagacagcattggcgacttggttatagagtcatcagaaaattgcaaaccagcatggaagtcaggaaagcttattat |
110 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4065094 |
cagagattcaaataacctggaatttagacagcattggcgacttggttatagagtcatcagaaaattgcaaaccagcatggaagtcaggaaagcttattat |
4065193 |
T |
|
| Q |
111 |
tgctgatgggatatcaagtccttgattagcatctggagggtattcatcaatgtgcaagaagccctatgcagaccaa |
186 |
Q |
| |
|
||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4065194 |
tgctgatgggatatcaagtccttgagtagcatctggagggtattcatcaatgtgcaagaagccctatgcagaccaa |
4065269 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 117; E-Value: 2e-59
Query Start/End: Original strand, 18 - 178
Target Start/End: Original strand, 4058755 - 4058915
Alignment:
| Q |
18 |
tcaaataacctggaatttagacagcattggcgacttggttatagagtcatcagaaaattgcaaaccagcatggaagtcaggaaagcttattattgctgat |
117 |
Q |
| |
|
|||||||||||| |||||||| | ||||||||||||| |||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4058755 |
tcaaataacctgtaatttagataacattggcgacttgcttatagagtcattagaaaattgcaaaccagcatggaagtcaggaaagcttattattgctgat |
4058854 |
T |
|
| Q |
118 |
gggatatcaagtccttgattagcatctggagggtattcatcaatgtgcaagaagccctatg |
178 |
Q |
| |
|
||||| |||| ||| || || ||||||||||| |||||||||||||||||||||||||||| |
|
|
| T |
4058855 |
gggatgtcaaatccctggttggcatctggaggatattcatcaatgtgcaagaagccctatg |
4058915 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #3
Raw Score: 113; E-Value: 4e-57
Query Start/End: Original strand, 251 - 363
Target Start/End: Original strand, 4065334 - 4065446
Alignment:
| Q |
251 |
ttgaacacaccttatcaaactcgatatttaatacagccgatttaatctcacaaggaagtctgaggatcagctccatcactcctgatgatactttgtcttc |
350 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4065334 |
ttgaacacaccttatcaaactcgatatttaatacagccgatttaatctcacaaggaagtctgaggatcagctccatcactcctgatgatactttgtcttc |
4065433 |
T |
|
| Q |
351 |
agaaggtgaaaca |
363 |
Q |
| |
|
||||||||||||| |
|
|
| T |
4065434 |
agaaggtgaaaca |
4065446 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #4
Raw Score: 73; E-Value: 3e-33
Query Start/End: Original strand, 259 - 363
Target Start/End: Original strand, 4060169 - 4060273
Alignment:
| Q |
259 |
accttatcaaactcgatatttaatacagccgatttaatctcacaaggaagtctgaggatcagctccatcactcctgatgatactttgtcttcagaaggtg |
358 |
Q |
| |
|
||||||||||| || |||||||||||||| |||||||| |||||||||| |||||||| ||||||||||||||||| ||||||||||||||||||||| | |
|
|
| T |
4060169 |
accttatcaaaatctatatttaatacagcagatttaatatcacaaggaaatctgaggaccagctccatcactcctggtgatactttgtcttcagaaggcg |
4060268 |
T |
|
| Q |
359 |
aaaca |
363 |
Q |
| |
|
||||| |
|
|
| T |
4060269 |
aaaca |
4060273 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University