View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6464_low_11 (Length: 344)
Name: NF6464_low_11
Description: NF6464
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6464_low_11 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 262; Significance: 1e-146; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 262; E-Value: 1e-146
Query Start/End: Original strand, 11 - 272
Target Start/End: Original strand, 45801264 - 45801525
Alignment:
| Q |
11 |
cataggcggagatggaaacgggaccacaatagttcatacgaacaagtgctgaactgatattctgcgcaattgcatgtggatcggagcctttaggaacatg |
110 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45801264 |
cataggcggagatggaaacgggaccacaatagttcatacgaacaagtgctgaactgatattctgcgcaattgcatgtggatcggagcctttaggaacatg |
45801363 |
T |
 |
| Q |
111 |
acagttctctatatcccaccataccgatatcttcgccgtcgtatactgcgcctccgcgttagttgttgctccacctccgcccatctgatcttatcaccga |
210 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45801364 |
acagttctctatatcccaccataccgatatcttcgccgtcgtatactgcgcctccgcgttagttgttgctccacctccgcccatctgatcttatcaccga |
45801463 |
T |
 |
| Q |
211 |
tcttatctccgatcttaatttcacaaagatcgattcaaagtaactatacaaattacaaaacc |
272 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45801464 |
tcttatctccgatcttaatttcacaaagatcgattcaaagtaactatacaaattacaaaacc |
45801525 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University