View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6464_low_14 (Length: 309)
Name: NF6464_low_14
Description: NF6464
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6464_low_14 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 231; Significance: 1e-127; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 231; E-Value: 1e-127
Query Start/End: Original strand, 2 - 296
Target Start/End: Complemental strand, 50474637 - 50474343
Alignment:
| Q |
2 |
atataaccgggaccgtgtttaagttttttagtgtagnnnnnnnnataatcacagcagtataccatgattctactaaacttattgtcaaccaaacatgcac |
101 |
Q |
| |
|
||||||||||||| ||||| ||||||| ||||||| | ||||||| || ||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
50474637 |
atataaccgggactgtgttcaagttttaaagtgtagattttgttaaaatcacatcaatataccatgattctactaaacttattgtcaaccaaacatgcac |
50474538 |
T |
|
| Q |
102 |
tatgtcaggaattcttatgatagataatagctagacaaacaagaagttgctcgtgattagaatttcacttgttaaccttcaccaaataccttattgaatt |
201 |
Q |
| |
|
||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
50474537 |
tatgtcaggaatttttatgatagataatagctagacaaacaagaagttgctcgtgattagaatttcacttgttaaccttcaccaaataccttattgaatt |
50474438 |
T |
|
| Q |
202 |
ggctcactttttatgcttttacttttaaataaatggaatgctgaaattttaaacgctgctatcaaatttggaaacgtatgaaattgtgatctgtg |
296 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||| |
|
|
| T |
50474437 |
ggctcactttttatgcttttacttttaaataaatggaatgctgaaattttaaacgctattatcaaatttggaaacgtatgaaattgtgatctgtg |
50474343 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6 (Bit Score: 74; Significance: 6e-34; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 74; E-Value: 6e-34
Query Start/End: Original strand, 174 - 247
Target Start/End: Original strand, 28118661 - 28118734
Alignment:
| Q |
174 |
taaccttcaccaaataccttattgaattggctcactttttatgcttttacttttaaataaatggaatgctgaaa |
247 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
28118661 |
taaccttcaccaaataccttattgaattggctcactttttatgcttttacttttaaataaatggaatgctgaaa |
28118734 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University