View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6464_low_22 (Length: 241)
Name: NF6464_low_22
Description: NF6464
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6464_low_22 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 85; Significance: 1e-40; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 85; E-Value: 1e-40
Query Start/End: Original strand, 113 - 228
Target Start/End: Complemental strand, 41863871 - 41863753
Alignment:
| Q |
113 |
cattggcgtggcgattgtggcgccctcc---tccgaacaagtcagtaaccttgtgtccaattgagctatgctgctgctgctggtgttggttttcctgttg |
209 |
Q |
| |
|
|||||||||||||||||||| ||||||| |||||||||||||||||||||| ||||||||||||||||||||||||| ||||| ||||||| |||||| |
|
|
| T |
41863871 |
cattggcgtggcgattgtggtgccctccaagtccgaacaagtcagtaaccttgcgtccaattgagctatgctgctgctggtggtggtggtttttctgttg |
41863772 |
T |
|
| Q |
210 |
gcagctttgttcacaggtt |
228 |
Q |
| |
|
||||||||||||||||||| |
|
|
| T |
41863771 |
gcagctttgttcacaggtt |
41863753 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 54; E-Value: 4e-22
Query Start/End: Original strand, 45 - 118
Target Start/End: Complemental strand, 41863964 - 41863891
Alignment:
| Q |
45 |
ggttgcaattgttagtttgatgtttggcaacatgccctggttgataaatcacctccgtttggctatagcattgg |
118 |
Q |
| |
|
||||||| ||||||||||||||||||||||||||||||| |||||||||||||| |||||||||||| ||||| |
|
|
| T |
41863964 |
ggttgcatgtgttagtttgatgtttggcaacatgccctggctgataaatcacctctgtttggctatagtattgg |
41863891 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University