View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6464_low_25 (Length: 239)
Name: NF6464_low_25
Description: NF6464
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6464_low_25 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 129; Significance: 7e-67; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 129; E-Value: 7e-67
Query Start/End: Original strand, 1 - 133
Target Start/End: Complemental strand, 6058092 - 6057960
Alignment:
| Q |
1 |
atcgaaaaccctaaaaatccgaaaacgtgaaaattcgaaatcagaggtggttgattactgaattcgcggaaatggatcgtggttttgatgaattggaatg |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6058092 |
atcgaaaaccctaaaaatccgaaaacgtgaaaattcgaaatcagaggtggttgattactgaattcgcggaaatggatcgtggttttgatgaattggaatg |
6057993 |
T |
 |
| Q |
101 |
gtcctagggtttcgaattttggttttggtgatt |
133 |
Q |
| |
|
|| |||||||||||||||||||||||||||||| |
|
|
| T |
6057992 |
gttctagggtttcgaattttggttttggtgatt |
6057960 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University