View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6464_low_28 (Length: 211)
Name: NF6464_low_28
Description: NF6464
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6464_low_28 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 151; Significance: 4e-80; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 151; E-Value: 4e-80
Query Start/End: Original strand, 25 - 194
Target Start/End: Complemental strand, 44089819 - 44089652
Alignment:
| Q |
25 |
tccttgactcgtctcagtataattagaggatatagttttctaactaactaccaatacttagctgatgcactcaaataaacaaagataattttaattatca |
124 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||| ||||||||||||||||| |
|
|
| T |
44089819 |
tccttgactcgtctcagtataattagaggatatagttttctaactaactaccaatacttcgctgatgcactcaaataaaca--gataattttaattatca |
44089722 |
T |
|
| Q |
125 |
aatatgtaaaatgaatgtccctactataatcaaaacccaagaattcaagaataactcaagtgtcctttgc |
194 |
Q |
| |
|
||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44089721 |
aatatgtaaaatgaatgtcactactataatcaaaacccaagaattcaagaataactcaagtgtcctttgc |
44089652 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University