View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF6464_low_28 (Length: 211)

Name: NF6464_low_28
Description: NF6464
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF6464_low_28
NF6464_low_28
[»] chr3 (1 HSPs)
chr3 (25-194)||(44089652-44089819)


Alignment Details
Target: chr3 (Bit Score: 151; Significance: 4e-80; HSPs: 1)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 151; E-Value: 4e-80
Query Start/End: Original strand, 25 - 194
Target Start/End: Complemental strand, 44089819 - 44089652
Alignment:
25 tccttgactcgtctcagtataattagaggatatagttttctaactaactaccaatacttagctgatgcactcaaataaacaaagataattttaattatca 124  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||  |||||||||||||||||    
44089819 tccttgactcgtctcagtataattagaggatatagttttctaactaactaccaatacttcgctgatgcactcaaataaaca--gataattttaattatca 44089722  T
125 aatatgtaaaatgaatgtccctactataatcaaaacccaagaattcaagaataactcaagtgtcctttgc 194  Q
    ||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||    
44089721 aatatgtaaaatgaatgtcactactataatcaaaacccaagaattcaagaataactcaagtgtcctttgc 44089652  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University