View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6465_high_6 (Length: 236)
Name: NF6465_high_6
Description: NF6465
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6465_high_6 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 167; Significance: 1e-89; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 167; E-Value: 1e-89
Query Start/End: Original strand, 1 - 191
Target Start/End: Original strand, 37195665 - 37195855
Alignment:
| Q |
1 |
tcatcagaggtagaagaatatcctgttgatatttgaggttgtgaggttgctcccatttcaagaagtcttctcgagtatctcaagcttcgacggggattcg |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37195665 |
tcatcagaggtagaagaatatcctgttgatattttaggttgtgaggttgctcccatttcaagaagtcttctcgagtatctcaagcttcgacggggattcg |
37195764 |
T |
|
| Q |
101 |
gatttaattgtcttctcgggccttcccaagacccagactgaacctatacacaaagcaacaagttgaaagttaggatcacaccaacaagaca |
191 |
Q |
| |
|
|||||||||| ||||||||||||||||||||| | |||||||| |||||||||||||||||||||||||||||||||| |||||||||||| |
|
|
| T |
37195765 |
gatttaattgccttctcgggccttcccaagactcggactgaacatatacacaaagcaacaagttgaaagttaggatcaaaccaacaagaca |
37195855 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University