View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6466_high_12 (Length: 302)
Name: NF6466_high_12
Description: NF6466
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6466_high_12 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 215; Significance: 1e-118; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 215; E-Value: 1e-118
Query Start/End: Original strand, 2 - 264
Target Start/End: Original strand, 14984772 - 14985031
Alignment:
| Q |
2 |
gtttgtccttatttgcctcacctttaggcatacaaccctctgtgaatgttgatctaaactgctggatcctagagtggctgaactgtaatgatgttcgagg |
101 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
14984772 |
gtttgtccttatttgcctcacctttaggcatacaaccccctgtgaatgttgatctaaactgctggatcctagagtggctgaactgtaatgatgtttgagg |
14984871 |
T |
 |
| Q |
102 |
ctcacaatannnnnnnngtacaattctgtggaaagtctggtatgctaggaatcaggctgtgtttaatagtactccaacagacccaattagattggctcag |
201 |
Q |
| |
|
|||||||| |||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||| |||||||||||| |
|
|
| T |
14984872 |
ctcacaat---ttttttgtacaattctgtggaaagtctggtatgctaggaatcaggctgtgtttaatggtactccaacagacccaatcagattggctcag |
14984968 |
T |
 |
| Q |
202 |
tctgcagtgcagtttgtgcaggaacacgttgcagcaaacgcaaaattaagacccacacaggtt |
264 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
14984969 |
tctgcagtgcagtttgtgcaggaacacgttgcagcaaacgcaaaattaagacccacacaggtt |
14985031 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University