View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6466_high_14 (Length: 251)
Name: NF6466_high_14
Description: NF6466
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6466_high_14 |
 | |
|
| [»] chr2 (1 HSPs) |
| |
|
Alignment Details
Target: chr2 (Bit Score: 230; Significance: 1e-127; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 230; E-Value: 1e-127
Query Start/End: Original strand, 6 - 251
Target Start/End: Complemental strand, 11297998 - 11297753
Alignment:
| Q |
6 |
agaagcaaaggaaagaggaattgagaaggatgagggagataaagaagaataaaggtaaatcagaatatggctacccagaagaaggtgctcagaatatgga |
105 |
Q |
| |
|
|||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||| |
|
|
| T |
11297998 |
agaagcaatggaaagaggaattgagaaggatgagggagataaagaagaataaaggtaaatcagaatatggctacacagaagaaggtgctcagaatatgga |
11297899 |
T |
|
| Q |
106 |
aagtccagatgcagtgccgactccattgcatgatatgatcatgccgctatcctttgatggtgacaacccggtctttagatatcgtttcttagaatcaact |
205 |
Q |
| |
|
||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||| |
|
|
| T |
11297898 |
aagtccaaatgcagtgccgactccattgcatgatatgatcatgccgctatcctttgatggtgacaacccggtctttagatatcatttcttagaatcaact |
11297799 |
T |
|
| Q |
206 |
tcacagtttcttacgaggccggtgttggatgcgaatggttgggatc |
251 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
11297798 |
tcacagtttcttacgaggccggtgttggatgcgaatggttgggatc |
11297753 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University