View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6466_high_18 (Length: 239)
Name: NF6466_high_18
Description: NF6466
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6466_high_18 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 200; Significance: 1e-109; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 200; E-Value: 1e-109
Query Start/End: Original strand, 18 - 225
Target Start/End: Original strand, 11297364 - 11297571
Alignment:
| Q |
18 |
ataagcagaatcaccttgagacctcataagcccagcacttcctattaacaacaagcattttccaagagctatctgatcctcaactttcaatccagtagat |
117 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
11297364 |
ataagcagaatcaccttgagacctcataagcccagcacttcccattaacaacaagcattttccaagagctatctgatcctcaactttcaatccagtagat |
11297463 |
T |
|
| Q |
118 |
acattttcgcccaaaaacgtcgcagacacaccggcacaagttttatttcttttgaaattcttgaattccgtctctcccctaatgacgtaggctagttgct |
217 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||| |
|
|
| T |
11297464 |
acattttcgcccaaaaacgtcgcagacacaccggcacaagttttatttcttttgaaattcttgaattccgtctctcccctaacgacgtaggctagttgct |
11297563 |
T |
|
| Q |
218 |
ttcctatg |
225 |
Q |
| |
|
|||||||| |
|
|
| T |
11297564 |
ttcctatg |
11297571 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 30; Significance: 0.00000008; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 91 - 184
Target Start/End: Complemental strand, 36609371 - 36609278
Alignment:
| Q |
91 |
tgatcctcaactttcaatccagtagatacattttcgcccaaaaacgtcgcagacacaccggcacaagttttatttcttttgaaattcttgaatt |
184 |
Q |
| |
|
|||||||||| ||||| || || || |||||||| |||||||| ||| |||| || || || ||||||||||||||||||||| ||||||| |
|
|
| T |
36609371 |
tgatcctcaagtttcacaccggtggacacattttcacccaaaaatgtcacagatactccagctgcagttttatttcttttgaaatttttgaatt |
36609278 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University