View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6466_low_12 (Length: 302)
Name: NF6466_low_12
Description: NF6466
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6466_low_12 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 273; Significance: 1e-152; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 273; E-Value: 1e-152
Query Start/End: Original strand, 16 - 292
Target Start/End: Original strand, 43393116 - 43393392
Alignment:
| Q |
16 |
catgcatatggtttctagatattgatatgaattgctgaagttacttggacaatggaatggagatactcatagtaaggtttataattttacaaatcatgtt |
115 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43393116 |
catgcatatggtttctagatattgatatgaattgctgaagttacttggacaatggaatggagatactcatagtaaggtttataattttacaaatcatgtt |
43393215 |
T |
|
| Q |
116 |
cttttgccagaaagaaagttttattactcatgtctcatgatatgttttacagatattatttgttcctaagttgatacaaattacaataagatctatgaag |
215 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43393216 |
tttttgccagaaagaaagttttattactcatgtctcatgatatgttttacagatattatttgttcctaagttgatacaaattacaataagatctatgaag |
43393315 |
T |
|
| Q |
216 |
tgaatctcacttccctcaacccattgatggtgtcaaacaggattttttattttgattccagcttccatgtgtctctg |
292 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43393316 |
tgaatctcacttccctcaacccattgatggtgtcaaacaggattttttattttgattccagcttccatgtgtctctg |
43393392 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University