View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6466_low_14 (Length: 277)
Name: NF6466_low_14
Description: NF6466
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6466_low_14 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 236; Significance: 1e-130; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 236; E-Value: 1e-130
Query Start/End: Original strand, 18 - 264
Target Start/End: Complemental strand, 9956146 - 9955897
Alignment:
| Q |
18 |
acttgtttatagtaatgggtttgagactaatgataaaggaaatagatgtggtattgattaaactttctctttttatctctaattggatcatgttgaaaca |
117 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
9956146 |
acttgtttatagtaatgggtttgagactaatgataaaggaaatagatgtggtattgattaaactttctctttttatctctaattggatcatgttgaaaca |
9956047 |
T |
 |
| Q |
118 |
tctcttcatctttagcaagatt---agaaggttcaatttcatcttctctcattatactttttataatgacttgcagagttgggttcattgtgacataaat |
214 |
Q |
| |
|
|||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
9956046 |
tctcttcatctttagcaagattgttagaaggttcaatttcatcttctctcattatactttttataatgacttgcagagttgggttcattgtgacataaat |
9955947 |
T |
 |
| Q |
215 |
tgtcaattagctcttggcttcacaatatatatgtcatctggtgttgttgt |
264 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
9955946 |
tgtcaattagctcttggcttcacaatatatatgtcatctggtgttgttgt |
9955897 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University