View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6466_low_16 (Length: 250)
Name: NF6466_low_16
Description: NF6466
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6466_low_16 |
 | |
|
Alignment Details
Target: chr6 (Bit Score: 235; Significance: 1e-130; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 235; E-Value: 1e-130
Query Start/End: Original strand, 1 - 239
Target Start/End: Complemental strand, 3845006 - 3844768
Alignment:
| Q |
1 |
tgttttctgcgtttggctttgtacacaaacttgccacatttgaaaagactgcaggttttcaggttagtgaaatagtgaattgcacttctttcaatgtatc |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3845006 |
tgttttctgcgtttggctttgtacacaaacttgccacatttgaaaagactgcaggttttcaggttagtgaaatagtgaattgcacttctttcaatgtatc |
3844907 |
T |
|
| Q |
101 |
ttatcagtattcactattcactgtgtattatttatgggtaggctctgattcagtacactgatgctgagactgctgcttcggctaaggattcactcgatgg |
200 |
Q |
| |
|
||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3844906 |
ttatcagcattcactattcactgtgtattatttatgggtaggctctgattcagtacactgatgctgagactgctgcttcggctaaggattcactcgatgg |
3844807 |
T |
|
| Q |
201 |
aagaagcataccaaggcaagctctacttttacattttct |
239 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3844806 |
aagaagcataccaaggcaagctctacttttacattttct |
3844768 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 56; Significance: 3e-23; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 56; E-Value: 3e-23
Query Start/End: Original strand, 140 - 219
Target Start/End: Complemental strand, 2882102 - 2882023
Alignment:
| Q |
140 |
aggctctgattcagtacactgatgctgagactgctgcttcggctaaggattcactcgatggaagaagcataccaaggcaa |
219 |
Q |
| |
|
||||||||||||||| |||||||||||||||||||||||| |||| |||| | || |||||||||||||||||||||||| |
|
|
| T |
2882102 |
aggctctgattcagttcactgatgctgagactgctgcttcagctagggatgccctggatggaagaagcataccaaggcaa |
2882023 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 43; E-Value: 0.000000000000001
Query Start/End: Original strand, 1 - 71
Target Start/End: Complemental strand, 2882247 - 2882177
Alignment:
| Q |
1 |
tgttttctgcgtttggctttgtacacaaacttgccacatttgaaaagactgcaggttttcaggttagtgaa |
71 |
Q |
| |
|
|||||||||| ||||||||||| |||||| |||| ||||| |||||||| |||||||| |||||||||||| |
|
|
| T |
2882247 |
tgttttctgcttttggctttgttcacaaaattgctacattcgaaaagaccgcaggtttccaggttagtgaa |
2882177 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University