View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6467_high_12 (Length: 204)
Name: NF6467_high_12
Description: NF6467
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6467_high_12 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 160; Significance: 2e-85; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 160; E-Value: 2e-85
Query Start/End: Original strand, 1 - 189
Target Start/End: Original strand, 46848300 - 46848488
Alignment:
| Q |
1 |
atgttcagtggaatccatgattccaaagctttacgactactttcattcatatattcaagaacatattcttcaaaatccttagaaggtgagattttgaggc |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
46848300 |
atgttcagtggaatccatgattccaaagctttacgactactttcattcatatattcaagaacatattcttcaaaatccttagaaggtgagattttgaggc |
46848399 |
T |
|
| Q |
101 |
tatcccaacacatacaatccgttgtaagcttgattataattggccatgaatcattggannnnnnngatgcacccttattgctatattct |
189 |
Q |
| |
|
|||||||||||||||||||||||| ||||||||||||||||||||||||||||||||| |||||||||||||||||| ||||| |
|
|
| T |
46848400 |
tatcccaacacatacaatccgttgcaagcttgattataattggccatgaatcattggatttttttgatgcacccttattgctacattct |
46848488 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University