View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6467_low_11 (Length: 237)
Name: NF6467_low_11
Description: NF6467
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6467_low_11 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 206; Significance: 1e-113; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 206; E-Value: 1e-113
Query Start/End: Original strand, 1 - 222
Target Start/End: Original strand, 17408254 - 17408475
Alignment:
| Q |
1 |
tgttaatcttgattcatactttgcatttttacgtgtatagattgtgaccatctttattttttgtgatttttgattaataggttcatgtcttaccgaggga |
100 |
Q |
| |
|
||||||||||||||||| |||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||| |
|
|
| T |
17408254 |
tgttaatcttgattcattgtttgcatttttatgtgtatagattgtgaccatctttattttttgtgatttttgattaataggttcatgtgttaccgaggga |
17408353 |
T |
 |
| Q |
101 |
aatattcggaaaatcaacttatgaggtagctgttatgttgatgaaaaggttaccaatttggatggtcgataagatattgcttggtctaactcgtgtgatt |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
17408354 |
aatattcggaaaatcaacttatgaggtagctgttatgttgatgaaaaggttaccaatttggatggtcgataagatattgcttggtctaactcgtgtgatt |
17408453 |
T |
 |
| Q |
201 |
ttgggaaatgtcgaaaagtatg |
222 |
Q |
| |
|
|||||||||||||||||||||| |
|
|
| T |
17408454 |
ttgggaaatgtcgaaaagtatg |
17408475 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University