View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6467_low_12 (Length: 227)
Name: NF6467_low_12
Description: NF6467
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6467_low_12 |
 | |
|
| [»] chr1 (1 HSPs) |
| |
|
Alignment Details
Target: chr1 (Bit Score: 158; Significance: 3e-84; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 158; E-Value: 3e-84
Query Start/End: Original strand, 7 - 227
Target Start/End: Original strand, 26832922 - 26833143
Alignment:
| Q |
7 |
attaacactccttaaaaagcttgaattatagatggaaaaaatgattttcgtctccaatgttagcgtcaatgatacttgaccaaattaaagatgaatttca |
106 |
Q |
| |
|
|||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
26832922 |
attaacactccttaaaaagcttgaattagagatggaaaaaatgattttcgtctccaatgttagcgtcaatgatacttgaccaaattaaagatgaatttca |
26833021 |
T |
|
| Q |
107 |
-nnnnnnnnncttccttgaatttttacgtttctaattcaacnnnnnnnaatggcataaacgttactcgattattctacattttaggaaatatttgatgga |
205 |
Q |
| |
|
||||||||||||||||||||||||||||||| | |||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
26833022 |
ttttttttttcttccttgaatttttacgtttctaattcaactttttttagtggcataaacgttactcgattattctacattttaggaaatatttgatgga |
26833121 |
T |
|
| Q |
206 |
cggaaatgaaaaaccgatataa |
227 |
Q |
| |
|
|||||||||||||||||||||| |
|
|
| T |
26833122 |
cggaaatgaaaaaccgatataa |
26833143 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University