View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF6469_low_10 (Length: 270)

Name: NF6469_low_10
Description: NF6469
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF6469_low_10
NF6469_low_10
[»] chr6 (2 HSPs)
chr6 (137-258)||(17365390-17365511)
chr6 (3-113)||(17365109-17365219)
[»] chr5 (1 HSPs)
chr5 (2-136)||(23006803-23006937)
[»] chr1 (1 HSPs)
chr1 (2-137)||(20839315-20839450)
[»] scaffold0142 (1 HSPs)
scaffold0142 (189-258)||(12426-12495)


Alignment Details
Target: chr6 (Bit Score: 78; Significance: 2e-36; HSPs: 2)
Name: chr6
Description:

Target: chr6; HSP #1
Raw Score: 78; E-Value: 2e-36
Query Start/End: Original strand, 137 - 258
Target Start/End: Original strand, 17365390 - 17365511
Alignment:
137 tgaacaatgtactagccaaatacaaaatggctttaccattttattgggtaagattcccagcattacctagtgcagacttcaccttgtcttttgaacccaa 236  Q
    ||||||| | |||||||| |||||||||||||||| ||||||| |  ||||||||||||||||||||||||||||||||||| |||||||| ||||||||    
17365390 tgaacaacgcactagccagatacaaaatggctttagcattttactacgtaagattcccagcattacctagtgcagacttcactttgtctttcgaacccaa 17365489  T
237 ttacccttcttggttccatttt 258  Q
     |||||| ||||||||||||||    
17365490 ctaccctccttggttccatttt 17365511  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #2
Raw Score: 55; E-Value: 1e-22
Query Start/End: Original strand, 3 - 113
Target Start/End: Original strand, 17365109 - 17365219
Alignment:
3 aatgcactaaaagcttttctttgtggtggaaaaaatactacttcaccaaccttgttgatgaaccaacatttcgcactaaactgattagtgcttttccttc 102  Q
    |||||||  |||||||||||||||||||||| ||||||||||||| ||||||| ||||||| |||  |||||| || ||| |||| | ||| ||||||||    
17365109 aatgcaccgaaagcttttctttgtggtggaataaatactacttcaacaaccttattgatgagccagtatttcggacaaaattgatcaatgcgtttccttc 17365208  T
103 tttgcagaaca 113  Q
    |||||||||||    
17365209 tttgcagaaca 17365219  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5 (Bit Score: 47; Significance: 7e-18; HSPs: 1)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 47; E-Value: 7e-18
Query Start/End: Original strand, 2 - 136
Target Start/End: Original strand, 23006803 - 23006937
Alignment:
2 gaatgcactaaaagcttttctttgtggtggaaaaaatactacttcaccaaccttgttgatgaaccaacatttcgcactaaactgattagtgcttttcctt 101  Q
    ||||||||  |||| || ||||||||| |||||||||||||| |  |||||||||| || |||||| ||||||| || ||  |||| | |||||||||||    
23006803 gaatgcacagaaagtttctctttgtggaggaaaaaatactacctttccaaccttgtcgacgaaccagcatttcgtaccaacttgatcactgcttttcctt 23006902  T
102 ctttgcagaacatatcgaagaaaactaaaggtatg 136  Q
    ||||||||| ||  |||||| ||| ||||||||||    
23006903 ctttgcagagcaagtcgaaggaaaataaaggtatg 23006937  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1 (Bit Score: 40; Significance: 0.0000000000001; HSPs: 1)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 2 - 137
Target Start/End: Original strand, 20839315 - 20839450
Alignment:
2 gaatgcactaaaagcttttctttgtggtggaaaaaatactacttcaccaaccttgttgatgaaccaacatttcgcactaaactgattagtgcttttcctt 101  Q
    |||||||| ||||||||||||||||||| ||| ||||| ||| |  |||||||||| || ||| || ||||||   | || ||||| |||| ||||||||    
20839315 gaatgcaccaaaagcttttctttgtggtagaacaaatattacctttccaaccttgtcgacgaaacatcatttcatgcaaacctgatcagtgattttcctt 20839414  T
102 ctttgcagaacatatcgaagaaaactaaaggtatgt 137  Q
    |||||||||  |   ||||||||| |||||||||||    
20839415 ctttgcagagtaagacgaagaaaaataaaggtatgt 20839450  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0142 (Bit Score: 34; Significance: 0.0000000004; HSPs: 1)
Name: scaffold0142
Description:

Target: scaffold0142; HSP #1
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 189 - 258
Target Start/End: Original strand, 12426 - 12495
Alignment:
189 attcccagcattacctagtgcagacttcaccttgtcttttgaacccaattacccttcttggttccatttt 258  Q
    |||||||||||| ||||||||||||||||| |||||||| ||||| |  || ||| ||||||| ||||||    
12426 attcccagcattgcctagtgcagacttcactttgtctttcgaaccaagctatcctccttggtttcatttt 12495  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University