View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6469_low_11 (Length: 255)
Name: NF6469_low_11
Description: NF6469
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6469_low_11 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 195; Significance: 1e-106; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 195; E-Value: 1e-106
Query Start/End: Original strand, 1 - 243
Target Start/End: Original strand, 25146892 - 25147134
Alignment:
| Q |
1 |
atctgatgtgagatttgaatggtgtggagtgtctcctctttatagagtgtgaattagatagtgtggagtgcctcctttttataaacttatgttcagacca |
100 |
Q |
| |
|
||||||||||||||||| ||||||| |||||||||||||||||| ||||||||||||||||||||||||||||||| ||||||||||||||||||| ||| |
|
|
| T |
25146892 |
atctgatgtgagatttggatggtgtagagtgtctcctctttataaagtgtgaattagatagtgtggagtgcctcctctttataaacttatgttcaggcca |
25146991 |
T |
|
| Q |
101 |
tattttatctaatgtggcactatacatgggtgcggtagcctcgaatagggacccaccttattccaacgagaatttgagtcaatgatagcctcgaataagg |
200 |
Q |
| |
|
||||||||| |||||| ||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||| |
|
|
| T |
25146992 |
tattttatccgatgtgggactatacatgggtgcagtagcctcgaatagggacccaccttattccaacgagaatttgagtcggtgatagcctcgaataagg |
25147091 |
T |
|
| Q |
201 |
attattagtgatagtctcgtatagggatcacaatgttgcatct |
243 |
Q |
| |
|
|| |||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
25147092 |
atcattagtgatagtctcgtatagggatcacaatgttgcatct |
25147134 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 63 - 109
Target Start/End: Original strand, 25147465 - 25147511
Alignment:
| Q |
63 |
gtggagtgcctcctttttataaacttatgttcagaccatattttatc |
109 |
Q |
| |
|
|||||||||||||| ||||||||||||| || | ||||||||||||| |
|
|
| T |
25147465 |
gtggagtgcctcctctttataaacttatatttataccatattttatc |
25147511 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 34; Significance: 0.0000000004; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 173 - 242
Target Start/End: Original strand, 26460054 - 26460123
Alignment:
| Q |
173 |
tttgagtcaatgatagcctcgaataaggattattagtgatagtctcgtatagggatcacaatgttgcatc |
242 |
Q |
| |
|
||||||||| ||| | ||||||||||||| | ||||||| | |||||||| |||||||||||||||||| |
|
|
| T |
26460054 |
tttgagtcagtgacacactcgaataaggatcactagtgatggcctcgtataaggatcacaatgttgcatc |
26460123 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 29; Significance: 0.0000003; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 128 - 164
Target Start/End: Original strand, 26994257 - 26994293
Alignment:
| Q |
128 |
gggtgcggtagcctcgaatagggacccaccttattcc |
164 |
Q |
| |
|
||||| ||||||||||||||||||| ||||||||||| |
|
|
| T |
26994257 |
gggtgtggtagcctcgaatagggactcaccttattcc |
26994293 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University