View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6469_low_12 (Length: 251)
Name: NF6469_low_12
Description: NF6469
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6469_low_12 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 194; Significance: 1e-105; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 194; E-Value: 1e-105
Query Start/End: Original strand, 1 - 241
Target Start/End: Complemental strand, 25146656 - 25146422
Alignment:
| Q |
1 |
aacattttcattgccttagttttcactcttaaaatcatgtttaaattgcagtttgaactggttattagcctacataagataatctatcatcaatcaagag |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||| ||||||||||||||||||||||||| | |
|
|
| T |
25146656 |
aacattttcattgccttagttttcactcttaaaatcatgtttaaattgcagtttgaactagttattagcctagataagataatctatcatcaatcaaggg |
25146557 |
T |
|
| Q |
101 |
ccttgcagtaaacgatactctaaaatcagaataactctgttgcaagcaattaactacttactatcaaaatatacatatatgatgtgtgattctgttgaac |
200 |
Q |
| |
|
||||||| ||| ||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
25146556 |
ccttgcaataa------ctctaaaatcagaataactctgttgcaagcaatcaactacttactatcaaaatatacatatatgatgtgtgattctgttgaac |
25146463 |
T |
|
| Q |
201 |
cttttattttcatcaaacaatatatacataacattgttcat |
241 |
Q |
| |
|
|||||||||||||| |||||||||||||||||||||||||| |
|
|
| T |
25146462 |
cttttattttcatccaacaatatatacataacattgttcat |
25146422 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University