View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF6470_high_6 (Length: 255)

Name: NF6470_high_6
Description: NF6470
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF6470_high_6
NF6470_high_6
[»] chr5 (2 HSPs)
chr5 (147-240)||(17787692-17787784)
chr5 (23-62)||(17787782-17787821)


Alignment Details
Target: chr5 (Bit Score: 82; Significance: 8e-39; HSPs: 2)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 82; E-Value: 8e-39
Query Start/End: Original strand, 147 - 240
Target Start/End: Complemental strand, 17787784 - 17787692
Alignment:
147 attctctgactctgggctagcatccatttctggtgttaagagtttctctgctcagcttagctaatcactaataatatacagattggtccctttg 240  Q
    |||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||| |||||    
17787784 attctctgactctgggctagcatccatttctggtgt-aagagtttctctgctcagcttagctaatcactaataatatacagattggtcactttg 17787692  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #2
Raw Score: 40; E-Value: 0.00000000000009
Query Start/End: Original strand, 23 - 62
Target Start/End: Complemental strand, 17787821 - 17787782
Alignment:
23 tccacatgtgttagggaaataggaatgatatggcaatatt 62  Q
    ||||||||||||||||||||||||||||||||||||||||    
17787821 tccacatgtgttagggaaataggaatgatatggcaatatt 17787782  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University