View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6470_high_6 (Length: 255)
Name: NF6470_high_6
Description: NF6470
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6470_high_6 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 82; Significance: 8e-39; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 82; E-Value: 8e-39
Query Start/End: Original strand, 147 - 240
Target Start/End: Complemental strand, 17787784 - 17787692
Alignment:
| Q |
147 |
attctctgactctgggctagcatccatttctggtgttaagagtttctctgctcagcttagctaatcactaataatatacagattggtccctttg |
240 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
17787784 |
attctctgactctgggctagcatccatttctggtgt-aagagtttctctgctcagcttagctaatcactaataatatacagattggtcactttg |
17787692 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 40; E-Value: 0.00000000000009
Query Start/End: Original strand, 23 - 62
Target Start/End: Complemental strand, 17787821 - 17787782
Alignment:
| Q |
23 |
tccacatgtgttagggaaataggaatgatatggcaatatt |
62 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
17787821 |
tccacatgtgttagggaaataggaatgatatggcaatatt |
17787782 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University