View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6470_low_7 (Length: 217)
Name: NF6470_low_7
Description: NF6470
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6470_low_7 |
 | |
|
| [»] chr5 (1 HSPs) |
| |
|
Alignment Details
Target: chr5 (Bit Score: 180; Significance: 2e-97; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 180; E-Value: 2e-97
Query Start/End: Original strand, 14 - 217
Target Start/End: Original strand, 17787509 - 17787712
Alignment:
| Q |
14 |
agatcaccaaaacaaaatcccaaagtctagctagtagctactcttgtcaggtatgatttaagatagatgagtaaacagaagagtgtgaacatttgatgat |
113 |
Q |
| |
|
|||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||| |
|
|
| T |
17787509 |
agatcatcaaaacaaaatcccaaagtctagctagtagctactcttgtcaggtatgatttaagatagatgagtgaacagaagagtgtgaacatttgatgat |
17787608 |
T |
|
| Q |
114 |
gttttgtgatgtttgtaattgtaacaagtagcaaagaaaaagtcagaaaaataaatcgtacatgttgatagaacccgtaaaatcaaagggaccaatctgt |
213 |
Q |
| |
|
|||||||| |||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||| ||||||||||| |
|
|
| T |
17787609 |
gttttgtggtgtttgtaattgtaactagtagcaaagaaaaagtcagaaaaataaatcgtacatgttgatagcacccgtaaaatcaaagtgaccaatctgt |
17787708 |
T |
|
| Q |
214 |
atat |
217 |
Q |
| |
|
|||| |
|
|
| T |
17787709 |
atat |
17787712 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University