View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6471_high_12 (Length: 263)
Name: NF6471_high_12
Description: NF6471
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6471_high_12 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 235; Significance: 1e-130; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 235; E-Value: 1e-130
Query Start/End: Original strand, 11 - 245
Target Start/End: Complemental strand, 32971329 - 32971095
Alignment:
| Q |
11 |
cagagagagaatccgatacaacatcaaaatgcgcgagcaacacagaattaggaataccgctgcggctatctccaccgccaccggcaaacacgaggtactt |
110 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32971329 |
cagagagagaatccgatacaacatcaaaatgcgcgagcaacacagaattaggaataccgctgcggctatctccaccgccaccggcaaacacgaggtactt |
32971230 |
T |
|
| Q |
111 |
tccggcgtcaactgcttccgtctccggcgaagatttatgatcggcagcgtcgtcggaggaatgatcatcatcggtggttacgttttggagcgatttgaga |
210 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32971229 |
tccggcgtcaactgcttccgtctccggcgaagatttatgatcggcagcgtcgtcggaggaatgatcatcatcggtggttacgttttggagcgatttgaga |
32971130 |
T |
|
| Q |
211 |
atggattgtgggatccaagcaacggagtataaagg |
245 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| |
|
|
| T |
32971129 |
atggattgtgggatccaagcaacggagtataaagg |
32971095 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University