View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6471_high_13 (Length: 259)
Name: NF6471_high_13
Description: NF6471
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6471_high_13 |
 |  |
|
| [»] scaffold0470 (1 HSPs) |
 |  |  |
|
Alignment Details
Target: scaffold0470 (Bit Score: 187; Significance: 1e-101; HSPs: 1)
Name: scaffold0470
Description:
Target: scaffold0470; HSP #1
Raw Score: 187; E-Value: 1e-101
Query Start/End: Original strand, 18 - 253
Target Start/End: Original strand, 1422 - 1661
Alignment:
| Q |
18 |
gttcttgatattatattgtaccaaacaagtctttaa----gtttatttgtttttccatctctttaaagtaattctctttcacttgctataaaccccaann |
113 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||| |||||||||||||||||||||||||||||||||| |
|
|
| T |
1422 |
gttcttgatattatattgtaccaaacaagtctttaattaagtttatttgtttttccatctcttaaaagtaattctctttcacttgctataaaccccaatt |
1521 |
T |
 |
| Q |
114 |
nnnnnnctctctttcaaatccatcaatgaactagaaaatctataaatgaatcttaatttgtacatgactctactcccccgacctcccttaacccgtaaaa |
213 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1522 |
ttttctctctctttcaaatccatcaatgaactagaaaatctataaatgaatcttaatttgtacatgactctactcccccgacctcccttaacccgtaaaa |
1621 |
T |
 |
| Q |
214 |
tctctatcccttctccactcttttgtgtctttcttctctc |
253 |
Q |
| |
|
|||||||||||||| ||||||||||||||| ||||||||| |
|
|
| T |
1622 |
tctctatcccttcttcactcttttgtgtctctcttctctc |
1661 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 187; Significance: 1e-101; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 187; E-Value: 1e-101
Query Start/End: Original strand, 18 - 253
Target Start/End: Original strand, 6612134 - 6612373
Alignment:
| Q |
18 |
gttcttgatattatattgtaccaaacaagtctttaa----gtttatttgtttttccatctctttaaagtaattctctttcacttgctataaaccccaann |
113 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||| |||||||||||||||||||||||||||||||||| |
|
|
| T |
6612134 |
gttcttgatattatattgtaccaaacaagtctttaattaagtttatttgtttttccatctcttaaaagtaattctctttcacttgctataaaccccaatt |
6612233 |
T |
 |
| Q |
114 |
nnnnnnctctctttcaaatccatcaatgaactagaaaatctataaatgaatcttaatttgtacatgactctactcccccgacctcccttaacccgtaaaa |
213 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6612234 |
ttttctctctctttcaaatccatcaatgaactagaaaatctataaatgaatcttaatttgtacatgactctactcccccgacctcccttaacccgtaaaa |
6612333 |
T |
 |
| Q |
214 |
tctctatcccttctccactcttttgtgtctttcttctctc |
253 |
Q |
| |
|
|||||||||||||| ||||||||||||||| ||||||||| |
|
|
| T |
6612334 |
tctctatcccttcttcactcttttgtgtctctcttctctc |
6612373 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 29 - 61
Target Start/End: Original strand, 6585539 - 6585571
Alignment:
| Q |
29 |
tatattgtaccaaacaagtctttaagtttattt |
61 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |
|
|
| T |
6585539 |
tatattgtaccaaacaagtctttaagtttattt |
6585571 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University