View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6471_high_17 (Length: 228)
Name: NF6471_high_17
Description: NF6471
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6471_high_17 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 173; Significance: 4e-93; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 173; E-Value: 4e-93
Query Start/End: Original strand, 2 - 222
Target Start/End: Complemental strand, 19374387 - 19374168
Alignment:
| Q |
2 |
ataaccaaaagtacaattaagactgctattgagaggtcggttaaaagatcaaaattatttcagatattattcttgaggtcgggctccagatacggaacag |
101 |
Q |
| |
|
||||||||| || ||||||||||||||||||||||||||||||||||||| ||||| |||||||||||||||||| ||||||| |||||||||||||| | |
|
|
| T |
19374387 |
ataaccaaatgtgcaattaagactgctattgagaggtcggttaaaagatccaaatt-tttcagatattattcttgtggtcgggttccagatacggaacgg |
19374289 |
T |
 |
| Q |
102 |
ggattatggaagggcgaacatggtagtatgatcgagcaaacacagcagtccattgcatgaaccaataattcggctaggttcgttgaacttcatttggtgg |
201 |
Q |
| |
|
||||| ||||| |||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
19374288 |
ggattttggaacggcgaacatggtagtatgatcgagcaaacagagcagtccattgcatgaaccaataattcggctaggttcgttgaacttcatttggtgg |
19374189 |
T |
 |
| Q |
202 |
tatgaataaccggcaatgggg |
222 |
Q |
| |
|
||||||| ||||||||||||| |
|
|
| T |
19374188 |
tatgaattaccggcaatgggg |
19374168 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 108; E-Value: 2e-54
Query Start/End: Original strand, 1 - 200
Target Start/End: Original strand, 19345024 - 19345222
Alignment:
| Q |
1 |
cataaccaaaagtacaattaagactgctattgagaggtcggttaaaagatcaaaattatttcagatattattcttgaggtcgggctccagatacggaaca |
100 |
Q |
| |
|
|||||||||| || |||||| |||||| ||||||||||||||||||||||| ||||| || ||||||||||||||| ||||||| |||||||||||||| |
|
|
| T |
19345024 |
cataaccaaatgtgcaattatgactgcaattgagaggtcggttaaaagatccaaatt-ttacagatattattcttgtggtcgggttccagatacggaacc |
19345122 |
T |
 |
| Q |
101 |
gggattatggaagggcgaacatggtagtatgatcgagcaaacacagcagtccattgcatgaaccaataattcggctaggttcgttgaacttcatttggtg |
200 |
Q |
| |
|
||||| ||||| | ||||||| ||||||||||||||||| ||||||||||||||||||||||||||| ||||||||| ||||||||||| |||||| |
|
|
| T |
19345123 |
aggattttggaacactggacatggttgtatgatcgagcaaacaaagcagtccattgcatgaaccaataattgggctaggttggttgaacttcagttggtg |
19345222 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University