View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6471_high_19 (Length: 225)
Name: NF6471_high_19
Description: NF6471
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6471_high_19 |
 | |
|
| [»] chr4 (1 HSPs) |
| |
|
Alignment Details
Target: chr4 (Bit Score: 191; Significance: 1e-104; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 191; E-Value: 1e-104
Query Start/End: Original strand, 15 - 225
Target Start/End: Complemental strand, 43396357 - 43396147
Alignment:
| Q |
15 |
aagcacaattttgatttcgacatttgtatgaagctctcccttcgagaatctctgaaacaaattcctctgctctttcaaaaacccattaagactatactcc |
114 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43396357 |
aagcacaattttgatttcgacatttgtatgaagctctcccttcgagaatctctgaaacaaattcctctgctctttcaaaaacccattaagactatactcc |
43396258 |
T |
|
| Q |
115 |
tccgtagtttcttcttcttccttcacaaaattcttcaccgtcgctatcttctcccacgaacacttggacgaagatatcgttctccggtgagcagattcca |
214 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||| |||| ||||||||||||||||||||||||||||||| |
|
|
| T |
43396257 |
tccgtagtttcttcttcttccttcacaaaattcttcaccggagctatcttctcccacgaacacgtggaagaagatatcgttctccggtgagcagattcca |
43396158 |
T |
|
| Q |
215 |
cgagtttcctc |
225 |
Q |
| |
|
|||| |||||| |
|
|
| T |
43396157 |
cgaggttcctc |
43396147 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University