View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6471_low_16 (Length: 239)
Name: NF6471_low_16
Description: NF6471
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6471_low_16 |
 |  |
|
| [»] chr2 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 156; Significance: 5e-83; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 156; E-Value: 5e-83
Query Start/End: Original strand, 16 - 239
Target Start/End: Original strand, 36939494 - 36939700
Alignment:
| Q |
16 |
cacaatttgtgaattaaggaatggccacattaatttgtgtttaatgacgataccaagccactatcttgaaagtggcacatggcactatcttttgtgcagt |
115 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||| |
|
|
| T |
36939494 |
cacaatttgtgaattaaggaatggccacattaattagtgtttaatgacgataccaagccactatcttgaaagtggctcatggcactatcttttgtg---- |
36939589 |
T |
 |
| Q |
116 |
gtgagtaactgtttagaatgtatgcgtaggagatacactccttgaattatatgtaggttctagagtagaaattatttgtagatattgtcttaaaatttga |
215 |
Q |
| |
|
|| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36939590 |
-------------tacaatgtatgcgtaggagatacactccttgaattatatgtaggttctagagtagaaattatttgtagatattgtcttaaaatttga |
36939676 |
T |
 |
| Q |
216 |
tagagtaagatttttgtgattagt |
239 |
Q |
| |
|
|||||||||||||||||||||||| |
|
|
| T |
36939677 |
tagagtaagatttttgtgattagt |
36939700 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University