View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6471_low_6 (Length: 381)
Name: NF6471_low_6
Description: NF6471
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6471_low_6 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 82; Significance: 1e-38; HSPs: 3)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 82; E-Value: 1e-38
Query Start/End: Original strand, 113 - 309
Target Start/End: Complemental strand, 27731412 - 27731224
Alignment:
| Q |
113 |
ggtcaagcagcttagtggttagagtaacgcaccttaagtgtggagaagtgtggaatcggagttcgaactcagacccctgaataataacgtccctgcagct |
212 |
Q |
| |
|
|||||||||| |||||| |||| |||| ||||||||||||||||||||| |||||| |||||||||| || |||||| |||||| ||||||||||||| |
|
|
| T |
27731412 |
ggtcaagcagtctagtgggtagactaacacaccttaagtgtggagaagtggggaatccgagttcgaacccaaacccctacataataccgtccctgcagct |
27731313 |
T |
|
| Q |
213 |
accaaccgagttgtgtcgattgtactta-gggacacatttcagataattttaataagtgaatatacatgattaacaatataagtgacaagatagcaaa |
309 |
Q |
| |
|
|||||| ||| |||| |||| ||||||| |||| || |||||||||||||||||||||||||||||||||| | |||||||||||||||| |
|
|
| T |
27731312 |
accaactgag---------ttgtccttatgggacacctttcggacaattttaataagtgaatatacatgattaacaatagatgtgacaagatagcaaa |
27731224 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 44; E-Value: 6e-16
Query Start/End: Original strand, 315 - 366
Target Start/End: Complemental strand, 27731196 - 27731145
Alignment:
| Q |
315 |
tagttttatggttagtatatctttaattctgattactcattcaagaaagaac |
366 |
Q |
| |
|
|||||||||| |||| |||||||||||||||||||||||||||||||||||| |
|
|
| T |
27731196 |
tagttttatgattagcatatctttaattctgattactcattcaagaaagaac |
27731145 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #3
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 56 - 97
Target Start/End: Complemental strand, 27731471 - 27731430
Alignment:
| Q |
56 |
atcttgttaaggaaaaaattggaatcacaagcctttcggaga |
97 |
Q |
| |
|
|||||||||||||||||| | |||||||||||||||| |||| |
|
|
| T |
27731471 |
atcttgttaaggaaaaaaatcgaatcacaagcctttctgaga |
27731430 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 31; Significance: 0.00000003; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 125 - 190
Target Start/End: Original strand, 31068892 - 31068958
Alignment:
| Q |
125 |
tagtggttagagtaacgcaccttaagtgtggagaagtgtggaat-cggagttcgaactcagacccct |
190 |
Q |
| |
|
||||||||||| | || ||| ||||||||||||||||| ||||| |||||||| ||||| ||||||| |
|
|
| T |
31068892 |
tagtggttagattcacacacattaagtgtggagaagtggggaatccggagttcaaactccgacccct |
31068958 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University