View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6473_low_14 (Length: 356)
Name: NF6473_low_14
Description: NF6473
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6473_low_14 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 285; Significance: 1e-160; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 285; E-Value: 1e-160
Query Start/End: Original strand, 16 - 343
Target Start/End: Complemental strand, 31301668 - 31301339
Alignment:
| Q |
16 |
atatcaaaccggcaagacatctgaatcatgattcaacttccttaaattgctcaaatcgggactaatccgtgatcgaattggtaaaataaccaaacagtac |
115 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31301668 |
atatcaaaccggcaagacatctgaatcatgattcaacttccttaaattgctcaaatcgggactaatccgtgatcgaattggtaaaataaccaaacagtac |
31301569 |
T |
|
| Q |
116 |
tatagaatggaccgttcggttcaagttttaaaacactgttctagtccataataaaaaat---atgcagtctagtttagtccccttgnnnnnnnntctata |
212 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||| |||||| |
|
|
| T |
31301568 |
tatagaatggaccgttcggttcaagttttaaaacactgttctagtccataataaaaaataggatgcagtctagtttagtccccttgaaaaaaaatctata |
31301469 |
T |
|
| Q |
213 |
aatagtttttcatcattacaaaatcgggagacggtagtcttggaagtttagtattttattaacttagtgcatgtttgaatttgcaccgagtttgacaaaa |
312 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31301468 |
aatagtttttcatcattacaaaatcgggagacggtagtcttggaagtttagta-tttattaacttagtgcatgtttgaatttgcaccgagtttgacaaaa |
31301370 |
T |
|
| Q |
313 |
tcacagagcaaaaaccacatgttgaagtttc |
343 |
Q |
| |
|
||||||||||||||||||||||||||||||| |
|
|
| T |
31301369 |
tcacagagcaaaaaccacatgttgaagtttc |
31301339 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University