View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF6473_low_23 (Length: 306)

Name: NF6473_low_23
Description: NF6473
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF6473_low_23
NF6473_low_23
[»] chr5 (1 HSPs)
chr5 (215-294)||(28524135-28524214)


Alignment Details
Target: chr5 (Bit Score: 68; Significance: 2e-30; HSPs: 1)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 68; E-Value: 2e-30
Query Start/End: Original strand, 215 - 294
Target Start/End: Complemental strand, 28524214 - 28524135
Alignment:
215 tgaattcataaacttgaaggaaacaaatgtgctgattgattgactaattttagtctatccaatgattcttttgatgttca 294  Q
    ||||||||||||||||||||||||||||||||||| |||||||||||||||||| |||||||| ||||||||||||||||    
28524214 tgaattcataaacttgaaggaaacaaatgtgctgactgattgactaattttagtttatccaataattcttttgatgttca 28524135  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University