View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6473_low_32 (Length: 239)
Name: NF6473_low_32
Description: NF6473
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6473_low_32 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 186; Significance: 1e-101; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 186; E-Value: 1e-101
Query Start/End: Original strand, 4 - 223
Target Start/End: Original strand, 6941984 - 6942196
Alignment:
| Q |
4 |
aaatcaattgctatttttgattaaaattgtttttcttttgtaagaacatgtttcttcccaccatactcattttcaacatgggggactccaaccataaact |
103 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||| |||| |||||||||||||||||||||||| |
|
|
| T |
6941984 |
aaatcaattgctatttttgattaaaattgtttttcttttataagaacatgtttcttcccaccat-------ttcatcatgggggactccaaccataaact |
6942076 |
T |
 |
| Q |
104 |
agtaaccaaattagtgacaaaatgcaactcccattaaagttgctgttatggggctgtcctaaaccaagttgatcaaaatgtatgtattgtattgtattag |
203 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6942077 |
agtaaccaaattagtgacaaaatgcaactcccattaaagttgctgttatggggctgtcctaaaccaagttgatcaaaatgtatgtattgtattgtattag |
6942176 |
T |
 |
| Q |
204 |
acggaattagtccatacatt |
223 |
Q |
| |
|
|||||||||||||||||||| |
|
|
| T |
6942177 |
acggaattagtccatacatt |
6942196 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University