View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6473_low_9 (Length: 384)
Name: NF6473_low_9
Description: NF6473
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6473_low_9 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 129; Significance: 1e-66; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 129; E-Value: 1e-66
Query Start/End: Original strand, 240 - 372
Target Start/End: Original strand, 30620944 - 30621076
Alignment:
| Q |
240 |
tacttacattatgaatccattgtctatagatgtagatgaaaccaacactatatagttcattttcaattttccattcaacttgggaattgttttgattgaa |
339 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
30620944 |
tacttacattatgaatccattgtctatagatgtagatgaaaccaacactatatagttcattttcaattttccattcaacttgggaattgttttgattgaa |
30621043 |
T |
|
| Q |
340 |
aattaaggaatgacgacaaatccacacaggttc |
372 |
Q |
| |
|
|||||||||||||||||||||||||| |||||| |
|
|
| T |
30621044 |
aattaaggaatgacgacaaatccacaaaggttc |
30621076 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 167 - 212
Target Start/End: Original strand, 51931066 - 51931111
Alignment:
| Q |
167 |
ttgtacacacaaactcaaagagctcttgacatcttaagggtgtttg |
212 |
Q |
| |
|
||||||||| |||||||||| | ||||||||||||||||| ||||| |
|
|
| T |
51931066 |
ttgtacacataaactcaaaggggtcttgacatcttaagggagtttg |
51931111 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University