View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6475_high_7 (Length: 238)
Name: NF6475_high_7
Description: NF6475
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6475_high_7 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 39; Significance: 0.0000000000003; HSPs: 3)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 39; E-Value: 0.0000000000003
Query Start/End: Original strand, 67 - 113
Target Start/End: Complemental strand, 116333 - 116287
Alignment:
| Q |
67 |
gtggattcctaacagaagaagacatgaatcaaatggtagaattgatt |
113 |
Q |
| |
|
||||||| ||||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
116333 |
gtggatttctaacggaagaagacatgaatcaaatggtagaattgatt |
116287 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 1 - 37
Target Start/End: Complemental strand, 116546 - 116510
Alignment:
| Q |
1 |
gtaataagtaattcatcgtctgggttacatgatctgt |
37 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| |
|
|
| T |
116546 |
gtaataagtaattcatcgtctgggttacatgatctgt |
116510 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #3
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 35 - 67
Target Start/End: Complemental strand, 116455 - 116423
Alignment:
| Q |
35 |
tgtaggaactcgatacaccaatgacctcagctg |
67 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |
|
|
| T |
116455 |
tgtaggaactcgatacaccaatgacctcagctg |
116423 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University