View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6475_low_5 (Length: 250)
Name: NF6475_low_5
Description: NF6475
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6475_low_5 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 207; Significance: 1e-113; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 207; E-Value: 1e-113
Query Start/End: Original strand, 1 - 240
Target Start/End: Original strand, 116610 - 116853
Alignment:
| Q |
1 |
ctgatatggatttacattgcccatcctgcttgattaatttcttccatttccgagttattctac----acttgtgagctcagagaatgataccatggccat |
96 |
Q |
| |
|
|||||||||||||||||||| |||||||||||||||||||||||| |||||||||| |||||| ||||||| ||||||||||||||||||||||||| |
|
|
| T |
116610 |
ctgatatggatttacattgctcatcctgcttgattaatttcttccctttccgagttgttctacgtacacttgtgggctcagagaatgataccatggccat |
116709 |
T |
 |
| Q |
97 |
ttttcgtgactgggaaagaatcgatttcgatgcccatctcaagcattctcttatttgctagcttaaacataccctcattattttttaatagattttcaaa |
196 |
Q |
| |
|
|||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
116710 |
ttttcgtgactgggaaagaatcgatttcgatgtccatctcaagcattctcttatttgctagcttaaacataccctcattattttttaatagattttcaaa |
116809 |
T |
 |
| Q |
197 |
tgacaatgcaattaaatgttgagtggttgttggagttgcctatg |
240 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
116810 |
tgacaatgcaattaaatgttgagtggttgttggagttgcctatg |
116853 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University