View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6477_high_19 (Length: 238)
Name: NF6477_high_19
Description: NF6477
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6477_high_19 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 176; Significance: 6e-95; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 176; E-Value: 6e-95
Query Start/End: Original strand, 20 - 224
Target Start/End: Original strand, 44675357 - 44675561
Alignment:
| Q |
20 |
taaaacataatgatatataagttagtcttttannnnnnnggttgaaaaatttagaagttagctagagttaagctgatccggctcataaatattgtaatgt |
119 |
Q |
| |
|
|||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44675357 |
taaaacataatgatatataagttagtcttttatttttttggttgaaaaatttagaagttagctagagttaagctgatccggctcataaatattgtaatgt |
44675456 |
T |
|
| Q |
120 |
tgcgattgctgtgttagttaacaataacatgcaaatagtttttgacaaaattttggataattttgtgtatcagtattttatttcgatttctcatagattt |
219 |
Q |
| |
|
|||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||| |
|
|
| T |
44675457 |
tgcgattgttgtgttagttaacaataacatgcaaatagtttttgacaaaattttggataattttgtgtatcagtgttttatttcgatttctcatagattt |
44675556 |
T |
|
| Q |
220 |
catct |
224 |
Q |
| |
|
||||| |
|
|
| T |
44675557 |
catct |
44675561 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University