View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6477_high_9 (Length: 345)
Name: NF6477_high_9
Description: NF6477
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6477_high_9 |
 |  |
|
| [»] scaffold0085 (1 HSPs) |
 |  |  |
|
Alignment Details
Target: chr3 (Bit Score: 234; Significance: 1e-129; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 234; E-Value: 1e-129
Query Start/End: Original strand, 81 - 334
Target Start/End: Original strand, 47836978 - 47837231
Alignment:
| Q |
81 |
cttcattataagaaaattacagagtgccttaaatgactattattaccatggtttcaaatcgcggtccacatctgcaactgcgaccgctaatatcgctgat |
180 |
Q |
| |
|
|||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
47836978 |
cttcattataagaaaattacagtgtgccttaaatgactattattaccatggtttcaaatcgcggtccacatctgcaactgcgaccgctaatatcgctgat |
47837077 |
T |
 |
| Q |
181 |
gtggtagcctctacatcgtcatcgcaattgcagtgtgatcttaaatcacttgtatgcttgcatcataactgcatcaaacgatttcggccatgtttgttca |
280 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||| |||||||||||||||||||| |
|
|
| T |
47837078 |
gtggtagcctctacatcgtcatcgcaattgcagtgtgatctaaaatcacttgtatgcttgcatcataactgcatcaaacaatttcggccatgtttgttca |
47837177 |
T |
 |
| Q |
281 |
aatcttctcaccaaaacataacatttcagaaccccaaatgtcagtctacttcat |
334 |
Q |
| |
|
|||||||||||||||| |||| |||||||||||||||||||||||||||||||| |
|
|
| T |
47837178 |
aatcttctcaccaaaatataaaatttcagaaccccaaatgtcagtctacttcat |
47837231 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 42; Significance: 0.000000000000008; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 42; E-Value: 0.000000000000008
Query Start/End: Original strand, 205 - 294
Target Start/End: Complemental strand, 38750884 - 38750795
Alignment:
| Q |
205 |
caattgcagtgtgatcttaaatcacttgtatgcttgcatcataactgcatcaaacgatttcggccatgtttgttcaaatcttctcaccaa |
294 |
Q |
| |
|
|||| ||| ||||||||| |||||| |||||| | ||||| |||||||||| ||||||| || ||||||||||||||||||||||||| |
|
|
| T |
38750884 |
caatagcattgtgatcttcaatcacgtgtatggtcgcatcggaactgcatcacacgattttggtaatgtttgttcaaatcttctcaccaa |
38750795 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0085 (Bit Score: 36; Significance: 0.00000000003; HSPs: 1)
Name: scaffold0085
Description:
Target: scaffold0085; HSP #1
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 203 - 290
Target Start/End: Complemental strand, 49972 - 49885
Alignment:
| Q |
203 |
cgcaattgcagtgtgatcttaaatcacttgtatgcttgcatcataactgcatcaaacgatttcggccatgtttgttcaaatcttctca |
290 |
Q |
| |
|
||||| || ||||| ||||| ||||| |||||| ||||| ||||||||| | ||||||||||||||||||||||||| ||||||| |
|
|
| T |
49972 |
cgcaagtgtagtgttatcttcaatcatgtgtatgggcgcatcgtaactgcataacacgatttcggccatgtttgttcaaaccttctca |
49885 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University