View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6477_low_11 (Length: 327)
Name: NF6477_low_11
Description: NF6477
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6477_low_11 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 279; Significance: 1e-156; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 279; E-Value: 1e-156
Query Start/End: Original strand, 12 - 321
Target Start/End: Original strand, 43906952 - 43907261
Alignment:
| Q |
12 |
taaaaccaagattgtctaatcttggtgcttaattaaagtacttaacaatggtgcaaaccatttagggatattagagattttgacattttaaacaatgtgg |
111 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43906952 |
taaaaccaagattgtctaatcttggtgcttaattaaagtacttaacaatggtgcaaaccatttagggatattagagattttgacattttaaacaatgtgg |
43907051 |
T |
 |
| Q |
112 |
actaacatcgataaatatcatgaaagcaacttaagctaacnnnnnnnnnctttgtttagtggtggagtcctctaatgttcactttgtaacaaccacaaac |
211 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43907052 |
actaacatcgataaatatcatgaaagcaacttaagctaactttttttttctttgtttagtggtggagtcctctaatgttcactttgtaacaaccacaaac |
43907151 |
T |
 |
| Q |
212 |
aaaatgccatgtcctaaagaacaagctcttcttaaactcttcaacaatgtctcaacttctttgcagcttcttttcttagtcctattttccattgccattt |
311 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43907152 |
aaaatgccatgtcctaaagaacaagctcttcttaaactcttcaacaatgtctcaacttctttgcagcttcttttcttagtcctattttccattgccattt |
43907251 |
T |
 |
| Q |
312 |
ttcttctcac |
321 |
Q |
| |
|
||||| |||| |
|
|
| T |
43907252 |
ttcttgtcac |
43907261 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University