View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6477_low_12 (Length: 296)
Name: NF6477_low_12
Description: NF6477
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6477_low_12 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 111; Significance: 5e-56; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 111; E-Value: 5e-56
Query Start/End: Original strand, 148 - 279
Target Start/End: Original strand, 39859329 - 39859462
Alignment:
| Q |
148 |
tccattacttttaggttgcacat--ccgctagtattcccaaggtattggcatctccaattttggagtattgggcttcataggtggaaaacctaatatgag |
245 |
Q |
| |
|
||||||||||||||| ||||||| |||||||||||| ||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39859329 |
tccattacttttaggatgcacatatccgctagtattcacaaggtattagcatctccaattttggagtattgggcttcataggtggaaaacctaatatgag |
39859428 |
T |
 |
| Q |
246 |
ggttgagttgaagctcttcggacgaaggaataac |
279 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| |
|
|
| T |
39859429 |
ggttgagttgaagctcttcggacgaaggaataac |
39859462 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 103; E-Value: 3e-51
Query Start/End: Original strand, 10 - 112
Target Start/End: Original strand, 39859191 - 39859293
Alignment:
| Q |
10 |
catcatcatccgtgtatatctcacacatgtatctttatagatacataaatattctagatacgtatcaatgaatatccttaaagtatttgatatgcatgta |
109 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39859191 |
catcatcatccgtgtatatctcacacatgtatctttatagatacataaatattctagatacgtatcaatgaatatccttaaagtatttgatatgcatgta |
39859290 |
T |
 |
| Q |
110 |
tcc |
112 |
Q |
| |
|
||| |
|
|
| T |
39859291 |
tcc |
39859293 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University