View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6478_high_16 (Length: 235)
Name: NF6478_high_16
Description: NF6478
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6478_high_16 |
 |  |
|
| [»] chr4 (9 HSPs) |
 |  |
|
| [»] scaffold1652 (4 HSPs) |
 |  |  |
|
| [»] scaffold0902 (3 HSPs) |
 |  |  |
|
| [»] scaffold1176 (3 HSPs) |
 |  |  |
|
| [»] scaffold0002 (1 HSPs) |
 |  |  |
|
| [»] scaffold1801 (3 HSPs) |
 |  |  |
|
Alignment Details
Target: chr4 (Bit Score: 198; Significance: 1e-108; HSPs: 9)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 198; E-Value: 1e-108
Query Start/End: Original strand, 18 - 235
Target Start/End: Original strand, 37245006 - 37245223
Alignment:
| Q |
18 |
ggagtaatagcaggaggaggagatggtggagagttgttggtggacggtgatggagaaggacggctcttcacaggtacgggagcagatgccgccgttgagt |
117 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| |||| ||||||||||||||||||||||||| |
|
|
| T |
37245006 |
ggagtaatagcaggaggaggagatggtggagagttgttggtggacggtgatggagaaggaatgctcttcgcaggcacgggagcagatgccgccgttgagt |
37245105 |
T |
 |
| Q |
118 |
tagcggagggagaaatcgctggtgatggtgcttgagatggaggagtagagatcgacgatggagtcacagcaggagcggcaacgggagaagcagcggcagc |
217 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37245106 |
tagcggagggagaaatcgctggtgatggtgcttgagatggaggagtagagatcgacgatggagtcacagcaggagcggcaacgggagaagcagcggcagc |
37245205 |
T |
 |
| Q |
218 |
tggagaatcaggagcggc |
235 |
Q |
| |
|
||||||| |||||||||| |
|
|
| T |
37245206 |
tggagaaccaggagcggc |
37245223 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 101; E-Value: 3e-50
Query Start/End: Original strand, 29 - 210
Target Start/End: Original strand, 37241994 - 37242181
Alignment:
| Q |
29 |
aggaggaggagatggtggagagttgttggtggacggtgatggagaaggacggctcttcacaggtacgggagcagatgccgccgttgagttagcg------ |
122 |
Q |
| |
|
||||||||||||||||||||||||| ||| ||||||||| |||||||||| |||| | ||||||||||||| ||||||| ||| |||||||||| |
|
|
| T |
37241994 |
aggaggaggagatggtggagagttgatggcggacggtgaaggagaaggactgctcgttacaggtacgggagaagatgccaccggtgagttagcgctggtg |
37242093 |
T |
 |
| Q |
123 |
gagggagaaatcgctggtgatggtgcttgagatggaggagtagagatcgacgatggagtcacagcaggagcggcaacgggagaagcag |
210 |
Q |
| |
|
||||||| |||||| |||||||||||||||||||||||||| ||||||||| ||||||| || |||||||||||||| |||||||||| |
|
|
| T |
37242094 |
gagggagcaatcgcaggtgatggtgcttgagatggaggagttgagatcgacaatggagtaactgcaggagcggcaacaggagaagcag |
37242181 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #3
Raw Score: 60; E-Value: 1e-25
Query Start/End: Original strand, 26 - 141
Target Start/End: Original strand, 37253096 - 37253211
Alignment:
| Q |
26 |
agcaggaggaggagatggtggagagttgttggtggacggtgatggagaaggacggctcttcacaggtacgggagcagatgccgccgttgagttagcggag |
125 |
Q |
| |
|
|||||||||||||||||||||||||||| ||| || ||||| ||||| ||| | |||||||||||| ||||||||||||||||| ||||| ||||||| |
|
|
| T |
37253096 |
agcaggaggaggagatggtggagagttgatggctgaaggtgaaggagatggagcgttcttcacaggtatgggagcagatgccgccggtgagtcagcggag |
37253195 |
T |
 |
| Q |
126 |
ggagaaatcgctggtg |
141 |
Q |
| |
|
||||| ||||| |||| |
|
|
| T |
37253196 |
ggagagatcgcaggtg |
37253211 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #4
Raw Score: 47; E-Value: 6e-18
Query Start/End: Original strand, 26 - 136
Target Start/End: Original strand, 37232847 - 37232957
Alignment:
| Q |
26 |
agcaggaggaggagatggtggagagttgttggtggacggtgatggagaaggacggctcttcacaggtacgggagcagatgccgccgttgagttagcggag |
125 |
Q |
| |
|
|||||||||||||||||||||||||||| ||| ||| || || ||||| ||| ||||||||||| |||||| |||||| |||| ||||| ||||||| |
|
|
| T |
37232847 |
agcaggaggaggagatggtggagagttgatggcggatggcgaaggagatggagaattcttcacaggtgcgggaggagatgcagccggtgagtgagcggag |
37232946 |
T |
 |
| Q |
126 |
ggagaaatcgc |
136 |
Q |
| |
|
||||| ||||| |
|
|
| T |
37232947 |
ggagagatcgc |
37232957 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #5
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 141 - 197
Target Start/End: Original strand, 37241923 - 37241979
Alignment:
| Q |
141 |
gatggtgcttgagatggaggagtagagatcgacgatggagtcacagcaggagcggca |
197 |
Q |
| |
|
|||||||||| || ||||||||||||||| ||||||||||| | ||||||||||||| |
|
|
| T |
37241923 |
gatggtgctttagttggaggagtagagattgacgatggagtaatagcaggagcggca |
37241979 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #6
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 82 - 141
Target Start/End: Original strand, 37237812 - 37237871
Alignment:
| Q |
82 |
tcttcacaggtacgggagcagatgccgccgttgagttagcggagggagaaatcgctggtg |
141 |
Q |
| |
|
|||||||||||||||||| ||||||| ||| ||||| |||||||||||| ||||| |||| |
|
|
| T |
37237812 |
tcttcacaggtacgggaggagatgccaccggtgagtcagcggagggagagatcgcaggtg |
37237871 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #7
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 140 - 196
Target Start/End: Original strand, 37232772 - 37232828
Alignment:
| Q |
140 |
tgatggtgcttgagatggaggagtagagatcgacgatggagtcacagcaggagcggc |
196 |
Q |
| |
|
||||||||||| || |||||||| |||||||| |||||||| |||||||||||||| |
|
|
| T |
37232772 |
tgatggtgcttcagcaggaggagtggagatcgatgatggagtaacagcaggagcggc |
37232828 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #8
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 138 - 194
Target Start/End: Original strand, 37237697 - 37237753
Alignment:
| Q |
138 |
ggtgatggtgcttgagatggaggagtagagatcgacgatggagtcacagcaggagcg |
194 |
Q |
| |
|
||||| ||||||| ||| |||||||||||||| || |||||||| |||||||||||| |
|
|
| T |
37237697 |
ggtgaaggtgcttcagaaggaggagtagagatggatgatggagtaacagcaggagcg |
37237753 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #9
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 140 - 178
Target Start/End: Original strand, 37241889 - 37241927
Alignment:
| Q |
140 |
tgatggtgcttgagatggaggagtagagatcgacgatgg |
178 |
Q |
| |
|
||||||||||| || |||||||||||||||||||||||| |
|
|
| T |
37241889 |
tgatggtgctttagttggaggagtagagatcgacgatgg |
37241927 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold1652 (Bit Score: 124; Significance: 6e-64; HSPs: 4)
Name: scaffold1652
Description:
Target: scaffold1652; HSP #1
Raw Score: 124; E-Value: 6e-64
Query Start/End: Original strand, 34 - 197
Target Start/End: Complemental strand, 501 - 338
Alignment:
| Q |
34 |
gaggagatggtggagagttgttggtggacggtgatggagaaggacggctcttcacaggtacgggagcagatgccgccgttgagttagcggagggagaaat |
133 |
Q |
| |
|
|||||||||||||||||||| ||| |||||||| |||||||||| |||||||||||||||||||||||||||| ||||||||||||||||||||||||| |
|
|
| T |
501 |
gaggagatggtggagagttgatggcagacggtgaaggagaaggactgctcttcacaggtacgggagcagatgccaccgttgagttagcggagggagaaat |
402 |
T |
 |
| Q |
134 |
cgctggtgatggtgcttgagatggaggagtagagatcgacgatggagtcacagcaggagcggca |
197 |
Q |
| |
|
||| || ||||||||||||||||||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
401 |
cgcaggctatggtgcttgagatggaggagtagatatcgacgatggagtcacagcaggagcggca |
338 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold1652; HSP #2
Raw Score: 47; E-Value: 6e-18
Query Start/End: Original strand, 128 - 206
Target Start/End: Complemental strand, 248 - 170
Alignment:
| Q |
128 |
agaaatcgctggtgatggtgcttgagatggaggagtagagatcgacgatggagtcacagcaggagcggcaacgggagaa |
206 |
Q |
| |
|
|||||||| || |||||| ||||||||||||||||||||||||||||||||| ||||||||||| ||| |||||||| |
|
|
| T |
248 |
agaaatcgtaggcgatggtacttgagatggaggagtagagatcgacgatggagagacagcaggagcagcagcgggagaa |
170 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold1652; HSP #3
Raw Score: 43; E-Value: 0.000000000000001
Query Start/End: Original strand, 126 - 192
Target Start/End: Complemental strand, 331 - 265
Alignment:
| Q |
126 |
ggagaaatcgctggtgatggtgcttgagatggaggagtagagatcgacgatggagtcacagcaggag |
192 |
Q |
| |
|
|||||||||| || |||||||||||||||||||| ||||||||||||||||||| |||||||||| |
|
|
| T |
331 |
ggagaaatcgtaggcgatggtgcttgagatggaggggtagagatcgacgatggagcgacagcaggag |
265 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold1652; HSP #4
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 140 - 192
Target Start/End: Complemental strand, 572 - 520
Alignment:
| Q |
140 |
tgatggtgcttgagatggaggagtagagatcgacgatggagtcacagcaggag |
192 |
Q |
| |
|
||||||||||| |||||| || |||||||||| ||||||||| | |||||||| |
|
|
| T |
572 |
tgatggtgctttagatggtggggtagagatcgccgatggagtaatagcaggag |
520 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0902 (Bit Score: 109; Significance: 6e-55; HSPs: 3)
Name: scaffold0902
Description:
Target: scaffold0902; HSP #1
Raw Score: 109; E-Value: 6e-55
Query Start/End: Original strand, 26 - 197
Target Start/End: Original strand, 3363 - 3537
Alignment:
| Q |
26 |
agcaggaggaggagatggtggagagttgttggtggacggtgatggagaaggacggctcttcacaggtacgggagcagat---gccgccgttgagttagcg |
122 |
Q |
| |
|
|||| ||||||||||||||||||||||| ||| |||||||| |||||||||| ||||||||||||||||||||||||| | ||| ||||||||||| |
|
|
| T |
3363 |
agcatgaggaggagatggtggagagttgatggcagacggtgaaggagaaggactgctcttcacaggtacgggagcagatatagatgccattgagttagcg |
3462 |
T |
 |
| Q |
123 |
gagggagaaatcgctggtgatggtgcttgagatggaggagtagagatcgacgatggagtcacagcaggagcggca |
197 |
Q |
| |
|
|||||||||||||| || | |||||||||||||||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
3463 |
gagggagaaatcgcaggcgttggtgcttgagatggaggagtagagatcgacgatggagtcacagcaggagtggca |
3537 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0902; HSP #2
Raw Score: 42; E-Value: 0.000000000000005
Query Start/End: Original strand, 141 - 206
Target Start/End: Original strand, 3574 - 3639
Alignment:
| Q |
141 |
gatggtgcttgagatggaggagtagagatcgacgatggagtcacagcaggagcggcaacgggagaa |
206 |
Q |
| |
|
||||||||||||| |||||| ||||||||||||||||||| ||||||||||| ||| |||||||| |
|
|
| T |
3574 |
gatggtgcttgagttggagggatagagatcgacgatggagtgacagcaggagcagcagcgggagaa |
3639 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0902; HSP #3
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 140 - 196
Target Start/End: Original strand, 3297 - 3353
Alignment:
| Q |
140 |
tgatggtgcttgagatggaggagtagagatcgacgatggagtcacagcaggagcggc |
196 |
Q |
| |
|
||||||||||| ||||||||| |||||||||| ||||||||| | ||||||||||| |
|
|
| T |
3297 |
tgatggtgctttagatggaggggtagagatcgccgatggagtaatggcaggagcggc |
3353 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold1176 (Bit Score: 96; Significance: 3e-47; HSPs: 3)
Name: scaffold1176
Description:
Target: scaffold1176; HSP #1
Raw Score: 96; E-Value: 3e-47
Query Start/End: Original strand, 34 - 193
Target Start/End: Complemental strand, 282 - 123
Alignment:
| Q |
34 |
gaggagatggtggagagttgttggtggacggtgatggagaaggacggctcttcacaggtacgggagcagatgccgccgttgagttagcggagggagaaat |
133 |
Q |
| |
|
||||||||||| ||||||| ||| || ||||| |||||||||| ||||||||||||| | |||||||| ||||| ||||||||||| ||||||||||| |
|
|
| T |
282 |
gaggagatggtctagagttgatggcagatggtgaaggagaaggactgctcttcacaggttcaggagcagacgccgcggttgagttagctgagggagaaat |
183 |
T |
 |
| Q |
134 |
cgctggtgatggtgcttgagatggaggagtagagatcgacgatggagtcacagcaggagc |
193 |
Q |
| |
|
||| || |||||||||||||||||||||||||||||||| |||||||||||||||||||| |
|
|
| T |
182 |
cgcaggcgatggtgcttgagatggaggagtagagatcgatgatggagtcacagcaggagc |
123 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold1176; HSP #2
Raw Score: 64; E-Value: 4e-28
Query Start/End: Original strand, 26 - 145
Target Start/End: Complemental strand, 1407 - 1288
Alignment:
| Q |
26 |
agcaggaggaggagatggtggagagttgttggtggacggtgatggagaaggacggctcttcacaggtacgggagcagatgccgccgttgagttagcggag |
125 |
Q |
| |
|
|||| ||||||||||||||||| ||||| ||| ||||||| |||||||||| ||||||||||||||| ||||| ||||||||||||||||||| ||| |
|
|
| T |
1407 |
agcatgaggaggagatggtggacagttgatggcacacggtgaaggagaaggactgctcttcacaggtacacgagcatatgccgccgttgagttagctgag |
1308 |
T |
 |
| Q |
126 |
ggagaaatcgctggtgatgg |
145 |
Q |
| |
|
||||||||||| || ||||| |
|
|
| T |
1307 |
ggagaaatcgcaggagatgg |
1288 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold1176; HSP #3
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 140 - 190
Target Start/End: Complemental strand, 353 - 303
Alignment:
| Q |
140 |
tgatggtgcttgagatggaggagtagagatcgacgatggagtcacagcagg |
190 |
Q |
| |
|
||||||||||| ||||||||| |||||||| ||||||||||| | |||||| |
|
|
| T |
353 |
tgatggtgctttagatggaggggtagagatggacgatggagtaatagcagg |
303 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6 (Bit Score: 77; Significance: 7e-36; HSPs: 7)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 77; E-Value: 7e-36
Query Start/End: Original strand, 31 - 193
Target Start/End: Original strand, 14316847 - 14317006
Alignment:
| Q |
31 |
gaggaggagatggtggagagttgttggtggacggtgatggagaaggacggctcttcacaggtacgggagcagatgccgccgttgagttagcggagggaga |
130 |
Q |
| |
|
|||||||||||| |||||||||| ||| |||||||| |||||||| ||||||||||||||||||||||||||| | |||||||||| || || || |
|
|
| T |
14316847 |
gaggaggagatgatggagagttgatggcagacggtgaaatagaaggactgctcttcacaggtacgggagcagatgctg---ttgagttagctgatgggga |
14316943 |
T |
 |
| Q |
131 |
aatcgctggtgatggtgcttgagatggaggagtagagatcgacgatggagtcacagcaggagc |
193 |
Q |
| |
|
|||||| || || ||||||||||| ||||||||||||||||| |||||||||||| ||||||| |
|
|
| T |
14316944 |
aatcgcaggcgagggtgcttgagacggaggagtagagatcgatgatggagtcacatcaggagc |
14317006 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 59; E-Value: 4e-25
Query Start/End: Original strand, 34 - 135
Target Start/End: Original strand, 14254119 - 14254223
Alignment:
| Q |
34 |
gaggagatggtggagagttgttggtggacggtgatggagaaggacggctcttcacaggtacgggagcagat---gccgccgttgagttagcggagggaga |
130 |
Q |
| |
|
|||||||||||||||||||| ||| |||||||| |||||||||| ||||||||||||||||||||||||| | ||||||||| ||||||||||||| |
|
|
| T |
14254119 |
gaggagatggtggagagttgatggcagacggtgaaggagaaggactgctcttcacaggtacgggagcagatgaagatgccgttgagctagcggagggaga |
14254218 |
T |
 |
| Q |
131 |
aatcg |
135 |
Q |
| |
|
||||| |
|
|
| T |
14254219 |
aatcg |
14254223 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #3
Raw Score: 53; E-Value: 1e-21
Query Start/End: Original strand, 125 - 193
Target Start/End: Original strand, 14248376 - 14248444
Alignment:
| Q |
125 |
gggagaaatcgctggtgatggtgcttgagatggaggagtagagatcgacgatggagtcacagcaggagc |
193 |
Q |
| |
|
|||||||||||| || |||||| |||||||||||||||||||||||||| ||||||||||||||||||| |
|
|
| T |
14248376 |
gggagaaatcgcaggcgatggtccttgagatggaggagtagagatcgaccatggagtcacagcaggagc |
14248444 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #4
Raw Score: 51; E-Value: 2e-20
Query Start/End: Original strand, 43 - 206
Target Start/End: Original strand, 14351555 - 14351724
Alignment:
| Q |
43 |
gtggagagttgttggtggacggtgatggagaaggacggctcttcacaggtacgggagcagatgccgccgttgagttagcg------gagggagaaatcgc |
136 |
Q |
| |
|
||||||||||| ||||||| | ||| |||||||||| ||||| ||||||| ||||| |||| | ||| |||||||||| ||| ||||||||| |
|
|
| T |
14351555 |
gtggagagttgatggtggatgatgaaggagaaggactactctttacaggtatgggagaagatatcaccggtgagttagcgccggttgagagagaaatcgt |
14351654 |
T |
 |
| Q |
137 |
tggtgatggtgcttgagatggaggagtagagatcgacgatggagtcacagcaggagcggcaacgggagaa |
206 |
Q |
| |
|
|| ||||||||||||||||| |||||||||| || |||||||| |||||||||||| || |||||||| |
|
|
| T |
14351655 |
aggcgatggtgcttgagatggtggagtagagactgatgatggagtaacagcaggagcgacagcgggagaa |
14351724 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #5
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 31 - 99
Target Start/End: Original strand, 14248312 - 14248380
Alignment:
| Q |
31 |
gaggaggagatggtggagagttgttggtggacggtgatggagaaggacggctcttcacaggtacgggag |
99 |
Q |
| |
|
|||||||||||| |||||||||| ||| |||||||| |||||||||| |||||||||||||| ||||| |
|
|
| T |
14248312 |
gaggaggagatgatggagagttgatggcagacggtgaaggagaaggactgctcttcacaggtatgggag |
14248380 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #6
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 140 - 181
Target Start/End: Original strand, 14248241 - 14248282
Alignment:
| Q |
140 |
tgatggtgcttgagatggaggagtagagatcgacgatggagt |
181 |
Q |
| |
|
||||||||||| ||||||||| |||||||||| ||||||||| |
|
|
| T |
14248241 |
tgatggtgctttagatggaggggtagagatcgccgatggagt |
14248282 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #7
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 140 - 192
Target Start/End: Original strand, 14254048 - 14254100
Alignment:
| Q |
140 |
tgatggtgcttgagatggaggagtagagatcgacgatggagtcacagcaggag |
192 |
Q |
| |
|
||||||| ||| ||||||||| ||||||||||||||||||| | |||||||| |
|
|
| T |
14254048 |
tgatggtactttagatggagggatagagatcgacgatggagtaatagcaggag |
14254100 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0002 (Bit Score: 53; Significance: 1e-21; HSPs: 1)
Name: scaffold0002
Description:
Target: scaffold0002; HSP #1
Raw Score: 53; E-Value: 1e-21
Query Start/End: Original strand, 125 - 193
Target Start/End: Complemental strand, 165350 - 165282
Alignment:
| Q |
125 |
gggagaaatcgctggtgatggtgcttgagatggaggagtagagatcgacgatggagtcacagcaggagc |
193 |
Q |
| |
|
|||||||||||| || |||||| |||||||||||||||||||||||||| ||||||||||||||||||| |
|
|
| T |
165350 |
gggagaaatcgcaggcgatggtccttgagatggaggagtagagatcgaccatggagtcacagcaggagc |
165282 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold1801 (Bit Score: 50; Significance: 9e-20; HSPs: 3)
Name: scaffold1801
Description:
Target: scaffold1801; HSP #1
Raw Score: 50; E-Value: 9e-20
Query Start/End: Original strand, 26 - 133
Target Start/End: Complemental strand, 174 - 70
Alignment:
| Q |
26 |
agcaggaggaggagatggtggagagttgttggtggacggtgatggagaaggacggctcttcacaggtacgggagcagatgccgccgttgagttagcggag |
125 |
Q |
| |
|
|||| ||||||||||| ||||||||||| ||| |||||||| |||||||||| |||||||||||| || ||||||||| ||||||| |||||| ||| |
|
|
| T |
174 |
agcatgaggaggagattgtggagagttgatggcagacggtgaaggagaaggactgctcttcacaggaacaggagcagat---gccgttgggttagccgag |
78 |
T |
 |
| Q |
126 |
ggagaaat |
133 |
Q |
| |
|
|||||||| |
|
|
| T |
77 |
ggagaaat |
70 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold1801; HSP #2
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 140 - 181
Target Start/End: Complemental strand, 240 - 199
Alignment:
| Q |
140 |
tgatggtgcttgagatggaggagtagagatcgacgatggagt |
181 |
Q |
| |
|
||||| ||||| ||||||||| |||||||||||||||||||| |
|
|
| T |
240 |
tgatgatgctttagatggaggggtagagatcgacgatggagt |
199 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold1801; HSP #3
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 154 - 186
Target Start/End: Complemental strand, 58 - 26
Alignment:
| Q |
154 |
atggaggagtagagatcgacgatggagtcacag |
186 |
Q |
| |
|
||||||||||||||||||||||| ||||||||| |
|
|
| T |
58 |
atggaggagtagagatcgacgatcgagtcacag |
26 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University