View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6478_high_4 (Length: 417)
Name: NF6478_high_4
Description: NF6478
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6478_high_4 |
 | |
|
Alignment Details
Target: chr6 (Bit Score: 75; Significance: 2e-34; HSPs: 4)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 75; E-Value: 2e-34
Query Start/End: Original strand, 305 - 383
Target Start/End: Complemental strand, 3002717 - 3002639
Alignment:
| Q |
305 |
tatcatatatagcttttcacaactcagtttagcagaattgaaaataaatcatatgttgaatttatttttcaactgtcca |
383 |
Q |
| |
|
||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3002717 |
tatcaaatatagcttttcacaactcagtttagcagaattgaaaataaatcatatgttgaatttatttttcaactgtcca |
3002639 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 72; E-Value: 1e-32
Query Start/End: Original strand, 56 - 147
Target Start/End: Complemental strand, 3011165 - 3011074
Alignment:
| Q |
56 |
attaagtagggataatcatcaacaatgatgcaagtagaacagtaacgagtgtcaatcacctcatgttggagtgacattatttgaataaaaat |
147 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||| ||| | ||||||||||| ||||||||||||||||||||||||||| |
|
|
| T |
3011165 |
attaagtagggataatcatcaacaatgatgcaagtagaacagtaaggagcataaatcacctcatattggagtgacattatttgaataaaaat |
3011074 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #3
Raw Score: 63; E-Value: 3e-27
Query Start/End: Original strand, 313 - 383
Target Start/End: Complemental strand, 3010972 - 3010902
Alignment:
| Q |
313 |
atagcttttcacaactcagtttagcagaattgaaaataaatcatatgttgaatttatttttcaactgtcca |
383 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| ||||| |
|
|
| T |
3010972 |
atagcttttcacaactcagtttagcagaattgaaaataaatcatatgttgaatttatttctcaacggtcca |
3010902 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #4
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 167 - 207
Target Start/End: Complemental strand, 3011077 - 3011037
Alignment:
| Q |
167 |
aaatactctgatagtttatttttgtaacaaaataggtcttt |
207 |
Q |
| |
|
|||||||| |||||||||||||||||||||||||| ||||| |
|
|
| T |
3011077 |
aaatactccgatagtttatttttgtaacaaaatagatcttt |
3011037 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University